Incidental Mutation 'R8178:Dnah6'
ID634475
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73060225 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3345 (T3345S)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect probably benign
Transcript: ENSMUST00000064948
AA Change: T3345S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: T3345S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114040
AA Change: T3293S

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: T3293S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204053
AA Change: T3345S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: T3345S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 splice site probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 splice site probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73169080 splice site probably null
R7735:Dnah6 UTSW 6 73069429 missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73025720 missense probably benign 0.41
R7829:Dnah6 UTSW 6 73127919 nonsense probably null
R7904:Dnah6 UTSW 6 73135467 splice site probably null
R8034:Dnah6 UTSW 6 73129225 missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73160913 missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73025786 missense probably damaging 1.00
R8206:Dnah6 UTSW 6 73037566 nonsense probably null
R8214:Dnah6 UTSW 6 73044728 missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73168827 critical splice donor site probably null
R8273:Dnah6 UTSW 6 73076599 missense probably benign 0.31
R8273:Dnah6 UTSW 6 73195681 missense probably benign 0.00
R8331:Dnah6 UTSW 6 73025000 missense probably benign 0.10
R8350:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8428:Dnah6 UTSW 6 73074651 missense probably benign 0.15
R8447:Dnah6 UTSW 6 73138774 missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8517:Dnah6 UTSW 6 73178457 missense probably benign 0.16
RF002:Dnah6 UTSW 6 73101889 missense probably benign
RF020:Dnah6 UTSW 6 73118057 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Z1176:Dnah6 UTSW 6 73087783 missense possibly damaging 0.79
Z1176:Dnah6 UTSW 6 73133559 missense probably benign
Z1177:Dnah6 UTSW 6 73021237 missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73032526 missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 73041138 missense probably damaging 1.00
Z1177:Dnah6 UTSW 6 73155272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CACAGATGTTATCACTTACAGCCAC -3'
(R):5'- GCTTGTCACATGGCTCAGTG -3'

Sequencing Primer
(F):5'- AAAGTGATCACGCGCTTCCTG -3'
(R):5'- TCACATGGCTCAGTGAATGTC -3'
Posted On2020-07-13