Incidental Mutation 'R8178:Gys2'
ID634476
Institutional Source Beutler Lab
Gene Symbol Gys2
Ensembl Gene ENSMUSG00000030244
Gene Nameglycogen synthase 2
Synonymsglycogen synthase, liver, LGS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142422613-142473109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142456412 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 234 (G234R)
Ref Sequence ENSEMBL: ENSMUSP00000032371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032371]
Predicted Effect probably damaging
Transcript: ENSMUST00000032371
AA Change: G234R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: G234R

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Gys2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
candy_corn UTSW 6 142456333 missense probably benign 0.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3151:Gys2 UTSW 6 142456333 missense probably benign 0.00
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4577:Gys2 UTSW 6 142454510 missense possibly damaging 0.93
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
R7663:Gys2 UTSW 6 142459485 missense probably damaging 1.00
R7757:Gys2 UTSW 6 142454451 missense probably benign 0.10
R7848:Gys2 UTSW 6 142446015 nonsense probably null
R7852:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R8008:Gys2 UTSW 6 142454517 missense probably damaging 1.00
R8037:Gys2 UTSW 6 142448393 missense probably benign 0.44
R8070:Gys2 UTSW 6 142448504 critical splice acceptor site probably null
R8152:Gys2 UTSW 6 142427410 missense probably benign
R8439:Gys2 UTSW 6 142461195 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGACAACTAGGAAACCGCAG -3'
(R):5'- TCAGACTTGAAGTGAACAGTGC -3'

Sequencing Primer
(F):5'- CACAGCAATTAAGCAAGGGTG -3'
(R):5'- GCTCTGAGGAAAACCTTG -3'
Posted On2020-07-13