Incidental Mutation 'R8178:Tial1'
ID634486
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene NameTia1 cytotoxic granule-associated RNA binding protein-like 1
SynonymsmTIAR, 5330433G13Rik, TIAR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128439777-128461717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128444890 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 209 (R209G)
Ref Sequence ENSEMBL: ENSMUSP00000101833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000141126] [ENSMUST00000165023] [ENSMUST00000205278] [ENSMUST00000205835]
Predicted Effect probably benign
Transcript: ENSMUST00000033135
AA Change: R192G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846
AA Change: R192G

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106226
AA Change: R209G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846
AA Change: R209G

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106228
AA Change: R153G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846
AA Change: R153G

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123666
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably benign
Transcript: ENSMUST00000133444
AA Change: R6G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000141126
AA Change: R61G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000165023
AA Change: R192G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846
AA Change: R192G

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205278
Predicted Effect probably benign
Transcript: ENSMUST00000205835
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128448345 missense probably damaging 1.00
IGL02623:Tial1 APN 7 128443883 missense probably benign 0.12
IGL02936:Tial1 APN 7 128442663 splice site probably benign
R0798:Tial1 UTSW 7 128443878 missense probably benign 0.04
R1583:Tial1 UTSW 7 128443910 missense probably damaging 1.00
R1913:Tial1 UTSW 7 128444659 missense probably damaging 1.00
R4863:Tial1 UTSW 7 128455028 missense probably damaging 1.00
R5026:Tial1 UTSW 7 128448396 missense probably damaging 0.97
R5039:Tial1 UTSW 7 128443968 intron probably benign
R5629:Tial1 UTSW 7 128444697 missense probably damaging 0.97
R6697:Tial1 UTSW 7 128444869 missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128442470 missense unknown
Z1177:Tial1 UTSW 7 128442639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAACGAATAGCCCTTCTCTGG -3'
(R):5'- AAGTGTTTCCCTCCCACTGG -3'

Sequencing Primer
(F):5'- TAGCCCTTCTCTGGAAAAACTCG -3'
(R):5'- GTCAGCCTAGTCCACATAGGTC -3'
Posted On2020-07-13