Incidental Mutation 'R8178:Nck1'
ID634494
Institutional Source Beutler Lab
Gene Symbol Nck1
Ensembl Gene ENSMUSG00000032475
Gene Namenon-catalytic region of tyrosine kinase adaptor protein 1
SynonymsD230010O13Rik, 6330586M15Rik, Nck
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location100492293-100546134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100497737 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 154 (W154R)
Ref Sequence ENSEMBL: ENSMUSP00000140971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112874] [ENSMUST00000116522] [ENSMUST00000186591] [ENSMUST00000188670]
Predicted Effect probably damaging
Transcript: ENSMUST00000112874
AA Change: W90R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108495
Gene: ENSMUSG00000032475
AA Change: W90R

DomainStartEndE-ValueType
SH3 45 100 3.58e-18 SMART
SH3 129 187 2.65e-21 SMART
SH2 216 298 1.6e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116522
AA Change: W154R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112221
Gene: ENSMUSG00000032475
AA Change: W154R

DomainStartEndE-ValueType
SH3 5 60 3.99e-16 SMART
SH3 109 164 3.58e-18 SMART
SH3 193 251 2.65e-21 SMART
SH2 280 362 1.6e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186591
AA Change: W154R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140971
Gene: ENSMUSG00000032475
AA Change: W154R

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
SH3 109 164 2.2e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188670
SMART Domains Protein: ENSMUSP00000140143
Gene: ENSMUSG00000032475

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
PDB:2CUB|A 99 132 2e-17 PDB
Blast:SH3 109 132 2e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Nck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Nck1 APN 9 100497737 missense probably damaging 1.00
IGL01608:Nck1 APN 9 100497387 missense probably benign
IGL02711:Nck1 APN 9 100508620 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R1549:Nck1 UTSW 9 100497872 missense probably benign
R2128:Nck1 UTSW 9 100497547 splice site probably null
R2314:Nck1 UTSW 9 100497950 missense probably damaging 1.00
R4744:Nck1 UTSW 9 100506744 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTGGGTCATTTTCCGGC -3'
(R):5'- ATAGCTTTGTTGATCCAGGAGAAC -3'

Sequencing Primer
(F):5'- GGGTCATTTTCCGGCTTTTCAATAAC -3'
(R):5'- TGATCCAGGAGAACGTCTCTATGAC -3'
Posted On2020-07-13