Incidental Mutation 'R8178:Pdxk'
ID634496
Institutional Source Beutler Lab
Gene Symbol Pdxk
Ensembl Gene ENSMUSG00000032788
Gene Namepyridoxal (pyridoxine, vitamin B6) kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78436744-78464975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78453504 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 38 (V38M)
Ref Sequence ENSEMBL: ENSMUSP00000038540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041616]
Predicted Effect probably damaging
Transcript: ENSMUST00000041616
AA Change: V38M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038540
Gene: ENSMUSG00000032788
AA Change: V38M

DomainStartEndE-ValueType
Pfam:Phos_pyr_kin 69 285 1.4e-18 PFAM
Pfam:PfkB 95 277 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105385
AA Change: V38M
SMART Domains Protein: ENSMUSP00000101024
Gene: ENSMUSG00000032788
AA Change: V38M

DomainStartEndE-ValueType
Pfam:PfkB 4 259 1.6e-32 PFAM
Pfam:Phos_pyr_kin 70 252 3.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Pdxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Pdxk APN 10 78451485 missense probably damaging 1.00
R1434:Pdxk UTSW 10 78440811 missense probably benign 0.01
R1572:Pdxk UTSW 10 78447980 missense probably damaging 1.00
R1719:Pdxk UTSW 10 78443896 missense probably benign
R1970:Pdxk UTSW 10 78441154 missense probably damaging 1.00
R2962:Pdxk UTSW 10 78443833 missense probably damaging 1.00
R4094:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4095:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4613:Pdxk UTSW 10 78447919 missense probably damaging 0.99
R4686:Pdxk UTSW 10 78447003 splice site probably null
R4783:Pdxk UTSW 10 78464792 missense possibly damaging 0.72
R4980:Pdxk UTSW 10 78451484 missense probably damaging 1.00
R5076:Pdxk UTSW 10 78450307 missense probably benign
R5847:Pdxk UTSW 10 78445038 missense probably benign
R6145:Pdxk UTSW 10 78443791 missense probably benign 0.44
R7109:Pdxk UTSW 10 78446976 missense probably damaging 1.00
R7399:Pdxk UTSW 10 78440863 missense probably benign 0.00
R7445:Pdxk UTSW 10 78447967 missense probably benign
R7629:Pdxk UTSW 10 78445006 missense probably benign
R7700:Pdxk UTSW 10 78443930 splice site probably null
R7936:Pdxk UTSW 10 78441178 missense possibly damaging 0.93
Z1176:Pdxk UTSW 10 78441188 missense probably damaging 1.00
Z1177:Pdxk UTSW 10 78443905 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGGTGTAAGAAGGGTCTGCC -3'
(R):5'- AAACATCTGGCTGGCTTGGC -3'

Sequencing Primer
(F):5'- CCTGCACAGAGTGACCCTTCTG -3'
(R):5'- AGGGGTTCGTGTTCCCAC -3'
Posted On2020-07-13