Incidental Mutation 'R8178:Glud1'
ID634509
Institutional Source Beutler Lab
Gene Symbol Glud1
Ensembl Gene ENSMUSG00000021794
Gene Nameglutamate dehydrogenase 1
SynonymsGdh-X, Glud
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location34310727-34345265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34343707 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 554 (G554D)
Ref Sequence ENSEMBL: ENSMUSP00000022322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022322]
Predicted Effect probably damaging
Transcript: ENSMUST00000022322
AA Change: G554D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022322
Gene: ENSMUSG00000021794
AA Change: G554D

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
Pfam:ELFV_dehydrog_N 112 242 1.3e-63 PFAM
ELFV_dehydrog 265 554 1.33e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163955
SMART Domains Protein: ENSMUSP00000130934
Gene: ENSMUSG00000021794

DomainStartEndE-ValueType
ELFV_dehydrog 2 139 5.91e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a conditionally allele activated in beta cells exhibit reduced glucose-stimulated insulin secretion and disorganization of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Glud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Glud1 APN 14 34336130 missense probably benign
IGL00973:Glud1 APN 14 34319942 missense probably damaging 1.00
IGL01896:Glud1 APN 14 34319905 missense probably benign 0.00
IGL02442:Glud1 APN 14 34335438 nonsense probably null
IGL03242:Glud1 APN 14 34334280 missense probably benign 0.00
PIT4283001:Glud1 UTSW 14 34336172 missense probably damaging 0.97
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0845:Glud1 UTSW 14 34329394 unclassified probably benign
R1765:Glud1 UTSW 14 34325584 splice site probably benign
R3870:Glud1 UTSW 14 34325580 splice site probably benign
R4645:Glud1 UTSW 14 34311106 missense probably damaging 1.00
R4773:Glud1 UTSW 14 34321825 critical splice donor site probably null
R4883:Glud1 UTSW 14 34335390 missense possibly damaging 0.56
R5912:Glud1 UTSW 14 34311343 critical splice donor site probably null
R6356:Glud1 UTSW 14 34311216 missense probably benign
R6443:Glud1 UTSW 14 34339927 missense probably benign 0.02
R7658:Glud1 UTSW 14 34311157 missense probably benign 0.25
R7806:Glud1 UTSW 14 34343649 missense probably damaging 1.00
R7817:Glud1 UTSW 14 34329287 critical splice acceptor site probably null
R7862:Glud1 UTSW 14 34325522 missense possibly damaging 0.74
R8398:Glud1 UTSW 14 34311271 missense probably benign 0.06
X0013:Glud1 UTSW 14 34338823 missense probably damaging 1.00
Z1177:Glud1 UTSW 14 34310869 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCCTTGTGTTAATAGCCTGC -3'
(R):5'- CACCTAACTGGCTTGGATACACG -3'

Sequencing Primer
(F):5'- AATAGCCTGCTACTCAGTCAGGTG -3'
(R):5'- ATACCATCAGCTTGTACATGATCC -3'
Posted On2020-07-13