Incidental Mutation 'R8179:Aox1'
ID634518
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58097958 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1169 (D1169G)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably damaging
Transcript: ENSMUST00000001027
AA Change: D1169G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: D1169G

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCTTCAGACTGGCCCAGC -3'
(R):5'- AGTGTTACTGTTTTCCATGGAAGAG -3'

Sequencing Primer
(F):5'- AGACTGGCCCAGCTTCCATC -3'
(R):5'- CATGGAAGAGATTATACCACTAAGGC -3'
Posted On2020-07-13