Incidental Mutation 'R8179:Vmn2r54'
ID634543
Institutional Source Beutler Lab
Gene Symbol Vmn2r54
Ensembl Gene ENSMUSG00000096593
Gene Namevomeronasal 2, receptor 54
SynonymsEG666085, Gm470, LOC232871, LOC385080
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12615233-12636134 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 12632091 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 305 (C305*)
Ref Sequence ENSEMBL: ENSMUSP00000083386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086210]
Predicted Effect probably null
Transcript: ENSMUST00000086210
AA Change: C305*
SMART Domains Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593
AA Change: C305*

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 4.3e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 1.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Vmn2r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn2r54 APN 7 12631913 splice site probably benign
IGL01778:Vmn2r54 APN 7 12632082 missense probably benign 0.07
IGL01998:Vmn2r54 APN 7 12615300 missense probably benign
IGL02028:Vmn2r54 APN 7 12632161 missense probably damaging 1.00
IGL02064:Vmn2r54 APN 7 12615606 missense probably benign 0.02
IGL02238:Vmn2r54 APN 7 12635983 missense probably damaging 1.00
IGL03062:Vmn2r54 APN 7 12632428 missense probably damaging 0.98
IGL03120:Vmn2r54 APN 7 12615387 missense probably damaging 1.00
PIT4453001:Vmn2r54 UTSW 7 12629742 missense probably benign 0.06
R0212:Vmn2r54 UTSW 7 12632497 missense probably benign
R0360:Vmn2r54 UTSW 7 12615649 missense probably damaging 1.00
R1646:Vmn2r54 UTSW 7 12632507 missense probably damaging 1.00
R1673:Vmn2r54 UTSW 7 12616211 critical splice acceptor site probably null
R1738:Vmn2r54 UTSW 7 12635888 missense probably benign 0.00
R1856:Vmn2r54 UTSW 7 12632311 missense probably benign
R2012:Vmn2r54 UTSW 7 12615877 missense probably damaging 1.00
R2038:Vmn2r54 UTSW 7 12629710 missense possibly damaging 0.94
R2160:Vmn2r54 UTSW 7 12615493 missense probably benign 0.29
R2397:Vmn2r54 UTSW 7 12615651 missense probably damaging 0.98
R2430:Vmn2r54 UTSW 7 12632006 missense probably damaging 0.99
R2829:Vmn2r54 UTSW 7 12615690 missense possibly damaging 0.62
R2975:Vmn2r54 UTSW 7 12635992 missense possibly damaging 0.92
R3005:Vmn2r54 UTSW 7 12615294 missense probably benign 0.28
R3725:Vmn2r54 UTSW 7 12632296 missense probably benign 0.42
R4486:Vmn2r54 UTSW 7 12632272 nonsense probably null
R4881:Vmn2r54 UTSW 7 12629671 missense probably benign 0.00
R4907:Vmn2r54 UTSW 7 12616223 splice site probably null
R5536:Vmn2r54 UTSW 7 12632416 missense probably benign 0.03
R5637:Vmn2r54 UTSW 7 12615369 missense probably benign 0.41
R5703:Vmn2r54 UTSW 7 12629667 missense probably benign 0.22
R5769:Vmn2r54 UTSW 7 12615282 missense possibly damaging 0.73
R5972:Vmn2r54 UTSW 7 12615352 missense probably damaging 1.00
R5972:Vmn2r54 UTSW 7 12635947 missense probably damaging 1.00
R5977:Vmn2r54 UTSW 7 12632216 missense probably damaging 1.00
R6084:Vmn2r54 UTSW 7 12632278 missense probably damaging 0.98
R6176:Vmn2r54 UTSW 7 12615981 missense probably damaging 1.00
R6229:Vmn2r54 UTSW 7 12631956 missense probably benign 0.00
R6371:Vmn2r54 UTSW 7 12615435 missense probably damaging 1.00
R6374:Vmn2r54 UTSW 7 12615493 missense probably damaging 1.00
R6804:Vmn2r54 UTSW 7 12629865 missense probably benign
R6886:Vmn2r54 UTSW 7 12632153 missense probably benign 0.02
R7041:Vmn2r54 UTSW 7 12629824 missense probably damaging 0.99
R7058:Vmn2r54 UTSW 7 12615795 missense possibly damaging 0.70
R7113:Vmn2r54 UTSW 7 12616074 missense probably damaging 1.00
R7124:Vmn2r54 UTSW 7 12622151 missense probably benign 0.00
R7126:Vmn2r54 UTSW 7 12632161 missense possibly damaging 0.91
R7236:Vmn2r54 UTSW 7 12631990 missense possibly damaging 0.84
R7337:Vmn2r54 UTSW 7 12622117 missense probably benign 0.00
R7406:Vmn2r54 UTSW 7 12616223 splice site probably null
R7634:Vmn2r54 UTSW 7 12615703 missense probably damaging 1.00
R7793:Vmn2r54 UTSW 7 12632269 missense probably damaging 0.98
R8139:Vmn2r54 UTSW 7 12615816 missense possibly damaging 0.92
R8158:Vmn2r54 UTSW 7 12615961 missense probably damaging 1.00
U24488:Vmn2r54 UTSW 7 12615429 missense possibly damaging 0.84
X0066:Vmn2r54 UTSW 7 12615370 missense probably damaging 1.00
Z1177:Vmn2r54 UTSW 7 12632108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCCCCAACCATCTATGAAGC -3'
(R):5'- GTGTTGCAAGGCACATTTGG -3'

Sequencing Primer
(F):5'- ATGTCTCTCTTACCTGCCAGGAATG -3'
(R):5'- GCCTTCTGTATCACAGCAGCAG -3'
Posted On2020-07-13