Incidental Mutation 'R8179:Olfr975'
ID634554
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Nameolfactory receptor 975
SynonymsMOR224-2, GA_x6K02T2PVTD-33651220-33650288
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39948131-39952046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39950412 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 120 (R120C)
Ref Sequence ENSEMBL: ENSMUSP00000059776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307]
Predicted Effect probably benign
Transcript: ENSMUST00000054067
AA Change: R120C

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: R120C

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 splice site probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2420:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4709:Olfr975 UTSW 9 39949869 missense probably damaging 0.97
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7080:Olfr975 UTSW 9 39950148 missense probably damaging 1.00
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
R8178:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8382:Olfr975 UTSW 9 39950159 missense probably benign 0.21
R8402:Olfr975 UTSW 9 39950417 missense probably benign 0.39
R8511:Olfr975 UTSW 9 39950159 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTTACAGCTTGTGCCAGAGAG -3'
(R):5'- AACCTGTCAGTGCTCGATATC -3'

Sequencing Primer
(F):5'- ACCACTGGAATGTCGCAG -3'
(R):5'- ACCTGTCAGTGCTCGATATCTTTTTC -3'
Posted On2020-07-13