Incidental Mutation 'R8179:Slit3'
ID634563
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35664076 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 912 (N912D)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect probably benign
Transcript: ENSMUST00000069837
AA Change: N912D

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: N912D

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
Bloated UTSW 11 35633952 missense possibly damaging 0.55
Quellung UTSW 11 35651820 critical splice donor site probably null
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
PIT4791001:Slit3 UTSW 11 35661245 missense possibly damaging 0.85
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
R6887:Slit3 UTSW 11 35544806 splice site probably null
R7067:Slit3 UTSW 11 35508230 missense probably benign 0.04
R7150:Slit3 UTSW 11 35570719 missense probably damaging 1.00
R7228:Slit3 UTSW 11 35599418 missense probably damaging 1.00
R7232:Slit3 UTSW 11 35610689 missense possibly damaging 0.87
R7418:Slit3 UTSW 11 35686428 missense possibly damaging 0.64
R7545:Slit3 UTSW 11 35700312 missense possibly damaging 0.52
R7727:Slit3 UTSW 11 35684044 missense probably damaging 1.00
R7820:Slit3 UTSW 11 35700408 missense probably benign 0.23
R8177:Slit3 UTSW 11 35579092 missense probably damaging 0.99
R8416:Slit3 UTSW 11 35508235 missense probably benign 0.08
R8417:Slit3 UTSW 11 35610611 missense probably damaging 0.99
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Z1176:Slit3 UTSW 11 35707924 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGATGTCCCGCTGTGATTC -3'
(R):5'- GGCTACATTACACAGCATCAGC -3'

Sequencing Primer
(F):5'- ACTCACTGGACAGTCGTTG -3'
(R):5'- ATCAGCTGCACAGGGCCTC -3'
Posted On2020-07-13