Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R8179:Ahr'
ID 634570
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission
Accession Numbers

Genbank: NM_013464; MGI: 105043

  
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R8179 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35497974-35535038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35510051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 201 (Q201R)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116436
AA Change: Q201R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: Q201R

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
BB002:Ahr UTSW 12 35515068 nonsense probably null
BB012:Ahr UTSW 12 35515068 nonsense probably null
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R0784:Ahr UTSW 12 35508142 missense possibly damaging 0.79
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
R7925:Ahr UTSW 12 35515068 nonsense probably null
R8274:Ahr UTSW 12 35510069 missense probably benign
R8342:Ahr UTSW 12 35508272 missense probably damaging 1.00
R8985:Ahr UTSW 12 35526737 missense possibly damaging 0.91
R9114:Ahr UTSW 12 35511165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACACTGCACCACTTGAG -3'
(R):5'- GGAGGCAAGTTCTACAGCATAG -3'

Sequencing Primer
(F):5'- GCACCACTTGAGTTAATTTACTGGTC -3'
(R):5'- ACAGCATAGAAGTGTTTATGTGTTTG -3'
Posted On 2020-07-13