Incidental Mutation 'R8179:Dnajc15'
ID634576
Institutional Source Beutler Lab
Gene Symbol Dnajc15
Ensembl Gene ENSMUSG00000022013
Gene NameDnaJ heat shock protein family (Hsp40) member C15
SynonymsDnajd1, 1110003P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location77820681-77875125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77852953 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 58 (I58N)
Ref Sequence ENSEMBL: ENSMUSP00000022590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022590]
Predicted Effect
SMART Domains Protein: ENSMUSP00000022590
Gene: ENSMUSG00000022013
AA Change: I58N

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
DnaJ 93 147 6.8e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mitochondrial activity that results in rapid metabolism in fasted mice or mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Dnajc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02607:Dnajc15 APN 14 77840216 missense probably damaging 1.00
R0321:Dnajc15 UTSW 14 77874833 missense possibly damaging 0.90
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R3774:Dnajc15 UTSW 14 77856937 critical splice donor site probably null
R4397:Dnajc15 UTSW 14 77874794 splice site probably null
R4747:Dnajc15 UTSW 14 77844456 missense probably benign 0.13
R5704:Dnajc15 UTSW 14 77826458 missense probably damaging 1.00
R7848:Dnajc15 UTSW 14 77840203 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGAATCAATTGTCTCCTTCCTC -3'
(R):5'- CATTAGCTAGAACGTGGTATGTG -3'

Sequencing Primer
(F):5'- TCCTCCCAACTGCCAGGTG -3'
(R):5'- ATTAAAGTCAAGGTCTGTCTGTTTAG -3'
Posted On2020-07-13