Incidental Mutation 'R8179:Aldh18a1'
ID634583
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40557508 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 612 (C612G)
Ref Sequence ENSEMBL: ENSMUSP00000025979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000175967] [ENSMUST00000176939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025979
AA Change: C612G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: C612G

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175967
SMART Domains Protein: ENSMUSP00000135419
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:2H5G|B 1 83 9e-52 PDB
SCOP:d1a4sa_ 11 95 1e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176939
AA Change: C610G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: C610G

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Map3k1 A C 13: 111,749,047 I1445M probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40557483 missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5135:Aldh18a1 UTSW 19 40554817 intron probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40577678 missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
R7935:Aldh18a1 UTSW 19 40573782 nonsense probably null
R7960:Aldh18a1 UTSW 19 40557820 missense probably benign 0.03
R8152:Aldh18a1 UTSW 19 40565012 missense probably benign 0.01
R8181:Aldh18a1 UTSW 19 40557437 missense probably benign 0.27
R8222:Aldh18a1 UTSW 19 40573852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGATTACATCTTTCGGGC -3'
(R):5'- TGTACGTGGATTCCGAAGCC -3'

Sequencing Primer
(F):5'- GTACTCAGCACAGCTCTGCATG -3'
(R):5'- ATTCCGAAGCCAGCGTG -3'
Posted On2020-07-13