Incidental Mutation 'R8181:Prkra'
ID 634588
Institutional Source Beutler Lab
Gene Symbol Prkra
Ensembl Gene ENSMUSG00000002731
Gene Name protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms lear, PRK, Pact, RAX
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock # R8181 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 76629898-76648015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 76639290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 142 (L142V)
Ref Sequence ENSEMBL: ENSMUSP00000002808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002808]
AlphaFold Q9WTX2
Predicted Effect probably damaging
Transcript: ENSMUST00000002808
AA Change: L142V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002808
Gene: ENSMUSG00000002731
AA Change: L142V

DomainStartEndE-ValueType
DSRM 35 100 4.63e-24 SMART
DSRM 127 193 2.23e-17 SMART
DSRM 241 307 1.16e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a deletion of the entire gene show embryonic lethality prior to implantation. Mice homozygous for a deletion in the last exon are viable but exhibit small size, turbinate hypoplasia, short snout, severe microtia, outer and middle ear defects, and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Prkra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Prkra APN 2 76630436 missense probably damaging 1.00
IGL02016:Prkra APN 2 76643309 splice site probably null
IGL02823:Prkra APN 2 76630424 missense probably damaging 1.00
IGL02962:Prkra APN 2 76633547 missense probably damaging 1.00
IGL03265:Prkra APN 2 76640270 missense probably benign 0.06
smallear UTSW 2 76630535 missense probably damaging 1.00
R1520:Prkra UTSW 2 76639278 missense possibly damaging 0.62
R1609:Prkra UTSW 2 76633592 missense probably benign 0.06
R1751:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R1767:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R2131:Prkra UTSW 2 76647136 missense probably damaging 1.00
R5288:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5385:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5386:Prkra UTSW 2 76639278 missense probably damaging 0.99
R6802:Prkra UTSW 2 76633537 missense probably damaging 1.00
R6918:Prkra UTSW 2 76630453 missense probably damaging 1.00
R7445:Prkra UTSW 2 76633598 missense probably benign 0.25
R7471:Prkra UTSW 2 76647201 missense probably benign 0.01
R8290:Prkra UTSW 2 76633638 missense probably damaging 0.98
R8749:Prkra UTSW 2 76630535 missense probably damaging 1.00
R9035:Prkra UTSW 2 76630512 missense probably benign 0.00
R9101:Prkra UTSW 2 76647840 missense probably benign 0.04
R9115:Prkra UTSW 2 76647849 missense probably benign
R9290:Prkra UTSW 2 76647803 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGAGCCTATAATTTGCCTG -3'
(R):5'- AACAGGGTGTTCTTGCAGTG -3'

Sequencing Primer
(F):5'- AGCCTATAATTTGCCTGTCTTTTCAG -3'
(R):5'- TGCAGTGTCCCATTGGC -3'
Posted On 2020-07-13