Incidental Mutation 'R8181:Plppr4'
ID634600
Institutional Source Beutler Lab
Gene Symbol Plppr4
Ensembl Gene ENSMUSG00000044667
Gene Namephospholipid phosphatase related 4
SynonymsLppr4, D3Bwg0562e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8181 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location117319139-117360876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117322465 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 581 (V581A)
Ref Sequence ENSEMBL: ENSMUSP00000052306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]
Predicted Effect probably damaging
Transcript: ENSMUST00000061071
AA Change: V581A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: V581A

DomainStartEndE-ValueType
acidPPc 180 324 4.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197743
AA Change: V523A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: V523A

DomainStartEndE-ValueType
SCOP:d1d2ta_ 59 268 1e-7 SMART
Blast:acidPPc 180 265 8e-53 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Plppr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plppr4 APN 3 117322220 missense probably benign 0.01
IGL01969:Plppr4 APN 3 117328359 missense probably damaging 1.00
IGL02014:Plppr4 APN 3 117335573 missense probably damaging 1.00
IGL02068:Plppr4 APN 3 117331784 splice site probably benign
IGL02426:Plppr4 APN 3 117322295 missense probably benign 0.01
IGL03203:Plppr4 APN 3 117325891 missense possibly damaging 0.89
PIT4445001:Plppr4 UTSW 3 117360308 unclassified probably benign
R0376:Plppr4 UTSW 3 117323091 missense probably benign 0.05
R0755:Plppr4 UTSW 3 117322670 missense possibly damaging 0.68
R0831:Plppr4 UTSW 3 117331646 critical splice donor site probably null
R1518:Plppr4 UTSW 3 117335503 missense probably damaging 1.00
R1523:Plppr4 UTSW 3 117322841 missense probably damaging 1.00
R1581:Plppr4 UTSW 3 117328266 missense possibly damaging 0.58
R1628:Plppr4 UTSW 3 117328272 missense probably damaging 1.00
R2510:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R2511:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R4332:Plppr4 UTSW 3 117322825 missense probably benign
R4380:Plppr4 UTSW 3 117322397 missense probably benign 0.40
R4787:Plppr4 UTSW 3 117322330 missense probably damaging 0.99
R4829:Plppr4 UTSW 3 117335591 missense possibly damaging 0.94
R5511:Plppr4 UTSW 3 117325902 missense probably benign 0.39
R5819:Plppr4 UTSW 3 117325864 missense possibly damaging 0.89
R6149:Plppr4 UTSW 3 117322394 missense probably benign 0.22
R6257:Plppr4 UTSW 3 117322579 missense possibly damaging 0.49
R6974:Plppr4 UTSW 3 117323018 missense probably damaging 1.00
R7045:Plppr4 UTSW 3 117360034 missense probably damaging 1.00
R7102:Plppr4 UTSW 3 117323183 missense probably damaging 0.98
R7507:Plppr4 UTSW 3 117322105 missense possibly damaging 0.76
R7820:Plppr4 UTSW 3 117321949 missense possibly damaging 0.88
R8179:Plppr4 UTSW 3 117331678 missense probably damaging 1.00
R8391:Plppr4 UTSW 3 117335411 missense probably benign 0.02
R8531:Plppr4 UTSW 3 117321943 missense probably damaging 1.00
R8762:Plppr4 UTSW 3 117325833 missense probably damaging 1.00
R8784:Plppr4 UTSW 3 117322541 nonsense probably null
R8933:Plppr4 UTSW 3 117323041 missense probably damaging 1.00
Z1176:Plppr4 UTSW 3 117322849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACGACGGGATCTGAATG -3'
(R):5'- CTCAAGATACAGCCTGGCAC -3'

Sequencing Primer
(F):5'- CGGGATCTGAATGATGGGCC -3'
(R):5'- TCCCCGGGTGCAACAATAGTATG -3'
Posted On2020-07-13