Incidental Mutation 'R8181:1110002E22Rik'
ID634601
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R8181 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138068395 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1115 (S1115N)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: S1115N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: S1115N

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGGATAACAGCAGAACCC -3'
(R):5'- GATGCCCTGTGAACCAAGAC -3'

Sequencing Primer
(F):5'- CAGCAGAAACTCTTCCGTGGTG -3'
(R):5'- GAGTTCAAGAGTCTACCGCCATTG -3'
Posted On2020-07-13