Incidental Mutation 'R8181:Muc3a'
ID634607
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Namemucin 3A, cell surface associated
SynonymsA630081J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8181 (G1)
Quality Score197.009
Status Validated
Chromosome5
Chromosomal Location137208813-137212389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137210078 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 206 (P206S)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
Predicted Effect unknown
Transcript: ENSMUST00000179412
AA Change: P206S
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: P206S

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196391
AA Change: P204S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R1536:Muc3a UTSW 5 137210081 missense unknown
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R5356:Muc3a UTSW 5 137210564 missense probably benign 0.33
R6134:Muc3a UTSW 5 137210122 missense probably damaging 0.99
R6491:Muc3a UTSW 5 137212128 missense probably benign 0.00
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCAAGTGGGTTTCTGTCAAAC -3'
(R):5'- TGAGGTCACCATGAAGGGTTAC -3'

Sequencing Primer
(F):5'- TGGGTTTCTGTCAAACAAAGAG -3'
(R):5'- TCACCATGAAGGGTTACTAAGC -3'
Posted On2020-07-13