Incidental Mutation 'R8181:Ticrr'
ID 634617
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 067605-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R8181 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79310728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: V214A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V214A

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206017
AA Change: V214A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: V214A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206622
AA Change: V214A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1792 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,774,156 (GRCm39) S1115N probably damaging Het
Abca1 A G 4: 53,059,303 (GRCm39) V1551A probably benign Het
Adam30 T C 3: 98,070,291 (GRCm39) I708T probably benign Het
Aknad1 T A 3: 108,659,328 (GRCm39) L114H possibly damaging Het
Akr1c18 G A 13: 4,185,262 (GRCm39) S290L probably benign Het
Aldh18a1 G T 19: 40,545,881 (GRCm39) D635E probably benign Het
Bax G T 7: 45,115,698 (GRCm39) P23Q probably null Het
Bhlha15 A T 5: 144,128,244 (GRCm39) N119Y probably damaging Het
Boll T A 1: 55,402,478 (GRCm39) M1L probably benign Het
C2cd2 A T 16: 97,693,502 (GRCm39) I123N probably benign Het
Cacnb4 A C 2: 52,364,997 (GRCm39) S89A probably benign Het
Calca A G 7: 114,234,387 (GRCm39) C21R probably benign Het
Calcr T C 6: 3,693,899 (GRCm39) I325M probably benign Het
Card14 T A 11: 119,212,718 (GRCm39) F94Y probably damaging Het
Chil3 A C 3: 106,057,203 (GRCm39) I247S probably damaging Het
Clca3b T C 3: 144,544,898 (GRCm39) N363S probably benign Het
Cnksr3 A G 10: 7,070,475 (GRCm39) V494A possibly damaging Het
Cog4 A G 8: 111,578,717 (GRCm39) probably null Het
Crybg1 T A 10: 43,862,322 (GRCm39) Y1484F probably damaging Het
Dglucy A G 12: 100,816,370 (GRCm39) probably null Het
Dmp1 T A 5: 104,359,380 (GRCm39) probably null Het
Dscaml1 T A 9: 45,658,140 (GRCm39) I1637N possibly damaging Het
Ercc6 T A 14: 32,279,905 (GRCm39) I640N probably damaging Het
Esp16 G T 17: 39,850,707 (GRCm39) E29* probably null Het
Fam149a T C 8: 45,834,755 (GRCm39) I15V possibly damaging Het
Flt4 T A 11: 49,525,723 (GRCm39) I724N probably damaging Het
Glb1 C T 9: 114,259,429 (GRCm39) R202C probably damaging Het
Gmpr2 C A 14: 55,910,441 (GRCm39) S41* probably null Het
Golgb1 T A 16: 36,737,192 (GRCm39) D2187E probably damaging Het
Gpsm2 A G 3: 108,597,080 (GRCm39) probably null Het
Helz A G 11: 107,563,399 (GRCm39) D1613G unknown Het
Hemgn A C 4: 46,396,504 (GRCm39) M244R possibly damaging Het
Hsd3b1 A T 3: 98,763,453 (GRCm39) V56E probably damaging Het
Jup A T 11: 100,267,751 (GRCm39) I524N probably damaging Het
Kdm1b G T 13: 47,205,377 (GRCm39) probably null Het
Kif11 A T 19: 37,379,095 (GRCm39) probably null Het
Lars1 A T 18: 42,361,835 (GRCm39) W591R probably damaging Het
Lrtm1 T A 14: 28,743,894 (GRCm39) S121T probably damaging Het
Med12l A C 3: 59,169,389 (GRCm39) D1593A probably damaging Het
Med17 A T 9: 15,188,928 (GRCm39) D112E possibly damaging Het
Mettl2 T A 11: 105,019,866 (GRCm39) F168I probably benign Het
Mmp9 A T 2: 164,792,365 (GRCm39) D323V probably damaging Het
Mpzl2 C T 9: 44,961,006 (GRCm39) T214I probably benign Het
Ms4a15 T C 19: 10,958,670 (GRCm39) H134R probably benign Het
Ms4a6d T A 19: 11,580,653 (GRCm39) I2F probably damaging Het
Muc3a G A 5: 137,244,535 (GRCm39) P206S unknown Het
Nectin2 C A 7: 19,458,733 (GRCm39) L359F probably damaging Het
Or2y6 C A 11: 52,104,096 (GRCm39) C240F probably damaging Het
Or4f53 T A 2: 111,087,918 (GRCm39) F153I probably benign Het
Pgm2 G T 5: 64,269,467 (GRCm39) C518F possibly damaging Het
Plppr4 A G 3: 117,116,114 (GRCm39) V581A probably damaging Het
Prkra G C 2: 76,469,634 (GRCm39) L142V probably damaging Het
Prpf38a G A 4: 108,434,195 (GRCm39) T74I probably benign Het
Ptprs T A 17: 56,736,064 (GRCm39) N635I probably damaging Het
Rxfp2 A G 5: 149,987,201 (GRCm39) N361D probably benign Het
Ryr3 T G 2: 112,608,588 (GRCm39) I2351L probably damaging Het
Sfmbt2 A T 2: 10,580,190 (GRCm39) T618S probably benign Het
Six6 A G 12: 72,986,906 (GRCm39) D26G probably damaging Het
Slc20a1 T C 2: 129,051,047 (GRCm39) L568P probably damaging Het
Slx4ip T A 2: 136,842,104 (GRCm39) C10S probably damaging Het
Sox13 G T 1: 133,311,498 (GRCm39) T578K probably benign Het
Spire2 A T 8: 124,088,042 (GRCm39) S509C probably damaging Het
Sptbn4 T C 7: 27,074,808 (GRCm39) D1521G possibly damaging Het
Sult2a7 T C 7: 14,204,098 (GRCm39) T207A probably benign Het
Sun2 A G 15: 79,609,721 (GRCm39) I708T probably damaging Het
Supt5 T C 7: 28,030,899 (GRCm39) E44G unknown Het
Thsd1 A G 8: 22,733,022 (GRCm39) E23G probably damaging Het
Vmn2r74 A T 7: 85,605,324 (GRCm39) F441L probably damaging Het
Zfp30 A G 7: 29,493,080 (GRCm39) T526A probably benign Het
Zfp518a G T 19: 40,902,415 (GRCm39) Q781H probably damaging Het
Zmynd11 A G 13: 9,739,687 (GRCm39) V434A probably benign Het
Zranb1 A G 7: 132,585,508 (GRCm39) D652G probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCAAGTTCTTCGACTCTCAGG -3'
(R):5'- TTGTTGGAGGAACGCTGTCC -3'

Sequencing Primer
(F):5'- ATGGAGACGCTGCTCGACTAC -3'
(R):5'- AGGAACGCTGTCCTTTGC -3'
Posted On 2020-07-13