Incidental Mutation 'R8181:Med17'
ID634624
Institutional Source Beutler Lab
Gene Symbol Med17
Ensembl Gene ENSMUSG00000031935
Gene Namemediator complex subunit 17
SynonymsTrap80, C330002H14Rik, Crsp6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8181 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location15260351-15279931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15277632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 112 (D112E)
Ref Sequence ENSEMBL: ENSMUSP00000034411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034411
AA Change: D112E

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935
AA Change: D112E

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Med17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Med17 APN 9 15279621 missense probably benign 0.19
IGL02263:Med17 APN 9 15267476 missense probably damaging 0.98
IGL02390:Med17 APN 9 15277667 nonsense probably null
IGL02391:Med17 APN 9 15277667 nonsense probably null
IGL02392:Med17 APN 9 15277667 nonsense probably null
IGL02393:Med17 APN 9 15277667 nonsense probably null
IGL02591:Med17 APN 9 15270361 missense probably damaging 1.00
IGL02635:Med17 APN 9 15274549 missense probably damaging 1.00
IGL02745:Med17 APN 9 15265346 splice site probably benign
IGL02815:Med17 APN 9 15262267 missense probably damaging 1.00
IGL02897:Med17 APN 9 15267534 missense probably damaging 1.00
R1448:Med17 UTSW 9 15275843 splice site probably null
R2912:Med17 UTSW 9 15275914 missense probably damaging 1.00
R2937:Med17 UTSW 9 15275891 missense probably damaging 0.99
R3715:Med17 UTSW 9 15263766 splice site probably benign
R4175:Med17 UTSW 9 15267469 missense possibly damaging 0.93
R4557:Med17 UTSW 9 15271697 missense possibly damaging 0.86
R4701:Med17 UTSW 9 15270360 missense probably damaging 1.00
R4865:Med17 UTSW 9 15265372 nonsense probably null
R5169:Med17 UTSW 9 15277604 missense probably benign 0.03
R5510:Med17 UTSW 9 15270404 missense probably benign
R6326:Med17 UTSW 9 15279558 missense probably benign 0.32
R6393:Med17 UTSW 9 15274583 missense probably damaging 1.00
R6598:Med17 UTSW 9 15271700 missense probably benign 0.29
R7722:Med17 UTSW 9 15271691 missense probably benign 0.01
R8348:Med17 UTSW 9 15262439 critical splice acceptor site probably null
R8377:Med17 UTSW 9 15262359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGTGCTCTTTCCTAACAC -3'
(R):5'- CTCTAAAAGAGCCACCTTCTGTTC -3'

Sequencing Primer
(F):5'- GATCTCCTAGAGCTGGACTTACAG -3'
(R):5'- AAAGAGCCACCTTCTGTTCTGTAG -3'
Posted On2020-07-13