Incidental Mutation 'R8181:Helz'
ID634634
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8181 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107672573 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1613 (D1613G)
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect unknown
Transcript: ENSMUST00000075012
AA Change: D1613G
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: D1613G

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100305
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106746
AA Change: D1612G
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: D1612G

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133862
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8729:Helz UTSW 11 107637928 critical splice donor site probably null
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8821:Helz UTSW 11 107635093 missense probably damaging 0.99
R8891:Helz UTSW 11 107662016 missense probably damaging 0.99
R8909:Helz UTSW 11 107666008 missense possibly damaging 0.94
R8922:Helz UTSW 11 107649159 missense possibly damaging 0.90
R8926:Helz UTSW 11 107672683 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGTAACTCTTGGGTGCCAG -3'
(R):5'- GGTGTTCAGATGGCAACGAG -3'

Sequencing Primer
(F):5'- GCCAGTTTGGGATTAATTTATGCC -3'
(R):5'- AGCCAAATAGCTGAGGCG -3'
Posted On2020-07-13