Incidental Mutation 'R0696:Lmnb1'
ID63466
Institutional Source Beutler Lab
Gene Symbol Lmnb1
Ensembl Gene ENSMUSG00000024590
Gene Namelamin B1
Synonyms
MMRRC Submission 038880-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0696 (G1)
Quality Score110
Status Not validated
Chromosome18
Chromosomal Location56707813-56753424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56740721 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 400 (T400A)
Ref Sequence ENSEMBL: ENSMUSP00000025486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025486]
Predicted Effect probably damaging
Transcript: ENSMUST00000025486
AA Change: T400A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025486
Gene: ENSMUSG00000024590
AA Change: T400A

DomainStartEndE-ValueType
Filament 32 388 2.59e-47 SMART
low complexity region 392 414 N/A INTRINSIC
Pfam:LTD 436 546 2.3e-18 PFAM
low complexity region 551 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two B-type lamin proteins and is a component of the nuclear lamina. A duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory distress, abnormal lung, craniofacial, and skeletal morphology, reduced embryo size, impaired cellular proliferation and differentiation, and abnormal nuclear morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,974 K189R probably benign Het
Arpp21 A T 9: 112,183,589 probably null Het
Atp6v1a G T 16: 44,087,471 Q603K probably benign Het
Bcorl1 C A X: 48,406,018 P1722H probably damaging Het
Cd209a C A 8: 3,748,384 A55S possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Cdsn A T 17: 35,555,996 Q474L possibly damaging Het
Col4a4 T A 1: 82,492,549 D753V unknown Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Cul7 C T 17: 46,659,608 P1084L probably damaging Het
Cyp7b1 T C 3: 18,072,585 T466A probably benign Het
Enpp2 C T 15: 54,897,696 W253* probably null Het
Igf2bp2 A T 16: 22,080,125 S245T probably benign Het
Mecom T C 3: 29,956,389 T724A probably benign Het
Mybl1 T C 1: 9,673,148 N560D probably damaging Het
Nav1 A G 1: 135,532,614 S324P probably damaging Het
Prrc2c C T 1: 162,708,852 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Slc7a1 A T 5: 148,340,556 V383E probably benign Het
St8sia5 A G 18: 77,254,464 N254S probably damaging Het
Stx19 A G 16: 62,822,043 K74R probably benign Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Uap1 G A 1: 170,149,274 P452L probably benign Het
Zfp101 C T 17: 33,381,427 A452T possibly damaging Het
Zfp820 A G 17: 21,820,060 S96P possibly damaging Het
Other mutations in Lmnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Lmnb1 APN 18 56740796 missense probably benign 0.37
IGL02139:Lmnb1 APN 18 56749799 missense probably benign 0.00
Katmai UTSW 18 56743276 nonsense probably null
R0446:Lmnb1 UTSW 18 56743259 missense probably benign 0.02
R1308:Lmnb1 UTSW 18 56728475 missense probably benign 0.06
R1309:Lmnb1 UTSW 18 56739904 frame shift probably null
R1544:Lmnb1 UTSW 18 56749751 missense probably benign 0.08
R2680:Lmnb1 UTSW 18 56731105 missense probably damaging 1.00
R3833:Lmnb1 UTSW 18 56728526 missense probably benign 0.01
R3980:Lmnb1 UTSW 18 56731019 missense probably damaging 1.00
R5820:Lmnb1 UTSW 18 56740786 missense possibly damaging 0.70
R6025:Lmnb1 UTSW 18 56729384 nonsense probably null
R6028:Lmnb1 UTSW 18 56743276 nonsense probably null
R6346:Lmnb1 UTSW 18 56743238 missense probably benign 0.24
R6736:Lmnb1 UTSW 18 56728469 missense probably damaging 1.00
R8013:Lmnb1 UTSW 18 56708359 missense probably damaging 1.00
RF004:Lmnb1 UTSW 18 56730974 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGACCCTTACTGGCAGAGTGTGAC -3'
(R):5'- CTTCAGCATCCAGAAGACGGATAGC -3'

Sequencing Primer
(F):5'- TGTGACATGGTGAGGGACC -3'
(R):5'- CTCAGAAGTGTTCTTCAAGCG -3'
Posted On2013-07-30