Incidental Mutation 'R8182:Bbs7'
ID634661
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8182 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36610223 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 100 (F100I)
Ref Sequence ENSEMBL: ENSMUSP00000047273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000142333]
Predicted Effect probably damaging
Transcript: ENSMUST00000040148
AA Change: F100I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: F100I

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108155
AA Change: F100I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: F100I

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108156
AA Change: F100I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: F100I

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142333
AA Change: F78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118961
Gene: ENSMUSG00000037325
AA Change: F78I

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGTGTATTGATTCCAGGTTC -3'
(R):5'- ACTCCGAAGTTAGAGTCTTCCTG -3'

Sequencing Primer
(F):5'- CCAGGTTCTGAATAATGAAATGCCTG -3'
(R):5'- GAGTCTTCCTGAAATGTACAAGTGG -3'
Posted On2020-07-13