Incidental Mutation 'R8182:Fip1l1'
ID 634669
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene Name factor interacting with PAPOLA and CPSF1
Synonyms Rje, 1300019H17Rik
MMRRC Submission 067606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 74696110-74759461 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74748813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000109164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000080164] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618] [ENSMUST00000127396]
AlphaFold Q9D824
Predicted Effect probably benign
Transcript: ENSMUST00000039744
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080164
AA Change: S362P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227
AA Change: S362P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087161
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113534
AA Change: S412P

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227
AA Change: S412P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113535
AA Change: S353P

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227
AA Change: S353P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113536
AA Change: S398P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227
AA Change: S398P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120618
AA Change: S406P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227
AA Change: S406P

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,272,774 (GRCm39) V1328A probably benign Het
Akna T C 4: 63,313,034 (GRCm39) Y363C probably damaging Het
Aph1c A G 9: 66,740,549 (GRCm39) I59T possibly damaging Het
Bbs7 A T 3: 36,664,372 (GRCm39) F100I probably damaging Het
Cibar1 T C 4: 12,171,842 (GRCm39) H30R probably benign Het
Eef2k G A 7: 120,472,626 (GRCm39) R113Q probably damaging Het
Fam221b G A 4: 43,660,342 (GRCm39) R416C probably damaging Het
Fam98b C A 2: 117,080,302 (GRCm39) D18E probably damaging Het
Fat2 T A 11: 55,175,223 (GRCm39) Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,526,861 (GRCm39) Q221L possibly damaging Het
Fbxo4 T C 15: 3,998,451 (GRCm39) R336G probably damaging Het
Fbxw15 A T 9: 109,384,778 (GRCm39) C341S probably benign Het
Fsip2 A G 2: 82,806,951 (GRCm39) D1090G probably damaging Het
Fyb1 T A 15: 6,681,293 (GRCm39) M706K probably benign Het
Glg1 A T 8: 111,897,929 (GRCm39) F747I possibly damaging Het
Gm8257 A G 14: 44,887,623 (GRCm39) L254P probably benign Het
Hnf4g T C 3: 3,716,679 (GRCm39) Y283H possibly damaging Het
Irx6 C A 8: 93,403,642 (GRCm39) Y122* probably null Het
Jph4 C T 14: 55,347,213 (GRCm39) G445R possibly damaging Het
Kif16b G T 2: 142,554,819 (GRCm39) R660S possibly damaging Het
Kif21a C T 15: 90,819,964 (GRCm39) G1556D possibly damaging Het
Kif3a T A 11: 53,485,133 (GRCm39) Y531* probably null Het
Lrp2 T C 2: 69,319,673 (GRCm39) D1950G probably damaging Het
Med23 T G 10: 24,788,705 (GRCm39) S1371A probably benign Het
Mef2a T A 7: 66,917,875 (GRCm39) E112D probably benign Het
Mxra8 C G 4: 155,925,589 (GRCm39) Y99* probably null Het
Nbeal1 A G 1: 60,239,292 (GRCm39) T112A probably benign Het
Or8b49 G A 9: 38,505,840 (GRCm39) V108I probably benign Het
Pclo G A 5: 14,905,634 (GRCm39) E4955K unknown Het
Poc1b T C 10: 98,991,005 (GRCm39) probably null Het
Ptbp2 A G 3: 119,534,078 (GRCm39) Y264H probably damaging Het
Rhobtb2 A G 14: 70,034,070 (GRCm39) V385A probably benign Het
Rlf G A 4: 121,008,102 (GRCm39) P403S possibly damaging Het
Rnase9 T C 14: 51,276,537 (GRCm39) N147S probably benign Het
Serpinb9f A G 13: 33,518,603 (GRCm39) I368V probably benign Het
Slc1a1 A T 19: 28,878,848 (GRCm39) T196S probably benign Het
Smarca2 A G 19: 26,608,120 (GRCm39) S60G probably benign Het
Tbc1d4 A T 14: 101,744,990 (GRCm39) V212E probably damaging Het
Thap12 T A 7: 98,365,584 (GRCm39) I584N probably damaging Het
Ube3b T A 5: 114,530,199 (GRCm39) N195K possibly damaging Het
Upk3b T C 5: 136,067,982 (GRCm39) C58R probably damaging Het
Ush1c A G 7: 45,847,775 (GRCm39) probably null Het
Vmn1r60 T C 7: 5,547,876 (GRCm39) T75A Het
Vmn2r77 T A 7: 86,460,801 (GRCm39) L709H probably damaging Het
Wdcp T C 12: 4,901,850 (GRCm39) S569P probably damaging Het
Zfp418 A T 7: 7,184,658 (GRCm39) N207I probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp808 G A 13: 62,319,521 (GRCm39) C250Y probably damaging Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74,747,726 (GRCm39) splice site probably benign
IGL02008:Fip1l1 APN 5 74,706,084 (GRCm39) missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74,752,534 (GRCm39) missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74,725,205 (GRCm39) missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74,731,813 (GRCm39) missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74,731,776 (GRCm39) missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74,717,770 (GRCm39) missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74,756,503 (GRCm39) missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74,756,503 (GRCm39) missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74,755,721 (GRCm39) unclassified probably benign
R1183:Fip1l1 UTSW 5 74,755,763 (GRCm39) missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74,706,796 (GRCm39) missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74,707,485 (GRCm39) missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74,748,852 (GRCm39) missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74,696,397 (GRCm39) missense probably damaging 1.00
R4440:Fip1l1 UTSW 5 74,697,446 (GRCm39) intron probably benign
R4825:Fip1l1 UTSW 5 74,748,866 (GRCm39) splice site probably null
R4838:Fip1l1 UTSW 5 74,752,600 (GRCm39) missense probably damaging 1.00
R5800:Fip1l1 UTSW 5 74,706,742 (GRCm39) missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74,752,608 (GRCm39) missense probably damaging 1.00
R6556:Fip1l1 UTSW 5 74,707,838 (GRCm39) critical splice donor site probably null
R6724:Fip1l1 UTSW 5 74,752,435 (GRCm39) missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74,702,734 (GRCm39) missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74,697,504 (GRCm39) missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74,748,736 (GRCm39) splice site probably null
R7325:Fip1l1 UTSW 5 74,697,460 (GRCm39) critical splice acceptor site probably null
R7590:Fip1l1 UTSW 5 74,752,435 (GRCm39) missense probably benign 0.41
R8826:Fip1l1 UTSW 5 74,725,188 (GRCm39) missense probably benign 0.01
R8905:Fip1l1 UTSW 5 74,756,624 (GRCm39) missense probably damaging 0.99
R8950:Fip1l1 UTSW 5 74,756,524 (GRCm39) missense probably damaging 1.00
R9154:Fip1l1 UTSW 5 74,747,703 (GRCm39) missense possibly damaging 0.95
R9372:Fip1l1 UTSW 5 74,707,463 (GRCm39) missense possibly damaging 0.64
R9473:Fip1l1 UTSW 5 74,745,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGGCTGAACAGTACCAG -3'
(R):5'- GAAGCAGTCTGTCAGATCTACAG -3'

Sequencing Primer
(F):5'- GCAAGTAGCTACTGGGTCTAAG -3'
(R):5'- GACTCTGCTAACTTAAGCC -3'
Posted On 2020-07-13