Incidental Mutation 'R8182:Fip1l1'
ID 634669
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene Name FIP1 like 1 (S. cerevisiae)
Synonyms 1300019H17Rik, Rje
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 74535449-74598800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74588152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000109164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000080164] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618] [ENSMUST00000127396]
AlphaFold Q9D824
Predicted Effect probably benign
Transcript: ENSMUST00000039744
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080164
AA Change: S362P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227
AA Change: S362P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087161
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113534
AA Change: S412P

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227
AA Change: S412P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113535
AA Change: S353P

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227
AA Change: S353P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113536
AA Change: S398P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227
AA Change: S398P

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120618
AA Change: S406P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227
AA Change: S406P

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74587065 splice site probably benign
IGL02008:Fip1l1 APN 5 74545423 missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74591873 missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74564544 missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74571152 missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74571115 missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74557109 missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74595060 unclassified probably benign
R1183:Fip1l1 UTSW 5 74595102 missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74546135 missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74546824 missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74588191 missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74535736 missense probably damaging 1.00
R4440:Fip1l1 UTSW 5 74536785 intron probably benign
R4825:Fip1l1 UTSW 5 74588205 splice site probably null
R4838:Fip1l1 UTSW 5 74591939 missense probably damaging 1.00
R5800:Fip1l1 UTSW 5 74546081 missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74591947 missense probably damaging 1.00
R6556:Fip1l1 UTSW 5 74547177 critical splice donor site probably null
R6724:Fip1l1 UTSW 5 74591774 missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74542073 missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74536843 missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74588075 splice site probably null
R7325:Fip1l1 UTSW 5 74536799 critical splice acceptor site probably null
R7590:Fip1l1 UTSW 5 74591774 missense probably benign 0.41
R8826:Fip1l1 UTSW 5 74564527 missense probably benign 0.01
R8905:Fip1l1 UTSW 5 74595963 missense probably damaging 0.99
R8950:Fip1l1 UTSW 5 74595863 missense probably damaging 1.00
R9154:Fip1l1 UTSW 5 74587042 missense possibly damaging 0.95
R9372:Fip1l1 UTSW 5 74546802 missense possibly damaging 0.64
R9473:Fip1l1 UTSW 5 74585058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGGCTGAACAGTACCAG -3'
(R):5'- GAAGCAGTCTGTCAGATCTACAG -3'

Sequencing Primer
(F):5'- GCAAGTAGCTACTGGGTCTAAG -3'
(R):5'- GACTCTGCTAACTTAAGCC -3'
Posted On 2020-07-13