Incidental Mutation 'R8182:Ube3b'
ID634671
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8182 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114392138 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 195 (N195K)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: N195K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: N195K

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151809
SMART Domains Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 5.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCTCTGGTTTGCCCTAAGG -3'
(R):5'- AAGAGGATGCTGCGTCTTC -3'

Sequencing Primer
(F):5'- AAGCCCCACTTGCTTAAGGTTAGG -3'
(R):5'- AGAGGATGCTGCGTCTTCAACTC -3'
Posted On2020-07-13