Incidental Mutation 'R8182:Ube3b'
ID 634671
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 067606-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114530199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 195 (N195K)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]
AlphaFold Q9ES34
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: N195K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: N195K

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151809
SMART Domains Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 5.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,272,774 (GRCm39) V1328A probably benign Het
Akna T C 4: 63,313,034 (GRCm39) Y363C probably damaging Het
Aph1c A G 9: 66,740,549 (GRCm39) I59T possibly damaging Het
Bbs7 A T 3: 36,664,372 (GRCm39) F100I probably damaging Het
Cibar1 T C 4: 12,171,842 (GRCm39) H30R probably benign Het
Eef2k G A 7: 120,472,626 (GRCm39) R113Q probably damaging Het
Fam221b G A 4: 43,660,342 (GRCm39) R416C probably damaging Het
Fam98b C A 2: 117,080,302 (GRCm39) D18E probably damaging Het
Fat2 T A 11: 55,175,223 (GRCm39) Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,526,861 (GRCm39) Q221L possibly damaging Het
Fbxo4 T C 15: 3,998,451 (GRCm39) R336G probably damaging Het
Fbxw15 A T 9: 109,384,778 (GRCm39) C341S probably benign Het
Fip1l1 T C 5: 74,748,813 (GRCm39) S398P probably damaging Het
Fsip2 A G 2: 82,806,951 (GRCm39) D1090G probably damaging Het
Fyb1 T A 15: 6,681,293 (GRCm39) M706K probably benign Het
Glg1 A T 8: 111,897,929 (GRCm39) F747I possibly damaging Het
Gm8257 A G 14: 44,887,623 (GRCm39) L254P probably benign Het
Hnf4g T C 3: 3,716,679 (GRCm39) Y283H possibly damaging Het
Irx6 C A 8: 93,403,642 (GRCm39) Y122* probably null Het
Jph4 C T 14: 55,347,213 (GRCm39) G445R possibly damaging Het
Kif16b G T 2: 142,554,819 (GRCm39) R660S possibly damaging Het
Kif21a C T 15: 90,819,964 (GRCm39) G1556D possibly damaging Het
Kif3a T A 11: 53,485,133 (GRCm39) Y531* probably null Het
Lrp2 T C 2: 69,319,673 (GRCm39) D1950G probably damaging Het
Med23 T G 10: 24,788,705 (GRCm39) S1371A probably benign Het
Mef2a T A 7: 66,917,875 (GRCm39) E112D probably benign Het
Mxra8 C G 4: 155,925,589 (GRCm39) Y99* probably null Het
Nbeal1 A G 1: 60,239,292 (GRCm39) T112A probably benign Het
Or8b49 G A 9: 38,505,840 (GRCm39) V108I probably benign Het
Pclo G A 5: 14,905,634 (GRCm39) E4955K unknown Het
Poc1b T C 10: 98,991,005 (GRCm39) probably null Het
Ptbp2 A G 3: 119,534,078 (GRCm39) Y264H probably damaging Het
Rhobtb2 A G 14: 70,034,070 (GRCm39) V385A probably benign Het
Rlf G A 4: 121,008,102 (GRCm39) P403S possibly damaging Het
Rnase9 T C 14: 51,276,537 (GRCm39) N147S probably benign Het
Serpinb9f A G 13: 33,518,603 (GRCm39) I368V probably benign Het
Slc1a1 A T 19: 28,878,848 (GRCm39) T196S probably benign Het
Smarca2 A G 19: 26,608,120 (GRCm39) S60G probably benign Het
Tbc1d4 A T 14: 101,744,990 (GRCm39) V212E probably damaging Het
Thap12 T A 7: 98,365,584 (GRCm39) I584N probably damaging Het
Upk3b T C 5: 136,067,982 (GRCm39) C58R probably damaging Het
Ush1c A G 7: 45,847,775 (GRCm39) probably null Het
Vmn1r60 T C 7: 5,547,876 (GRCm39) T75A Het
Vmn2r77 T A 7: 86,460,801 (GRCm39) L709H probably damaging Het
Wdcp T C 12: 4,901,850 (GRCm39) S569P probably damaging Het
Zfp418 A T 7: 7,184,658 (GRCm39) N207I probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp808 G A 13: 62,319,521 (GRCm39) C250Y probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCTCTGGTTTGCCCTAAGG -3'
(R):5'- AAGAGGATGCTGCGTCTTC -3'

Sequencing Primer
(F):5'- AAGCCCCACTTGCTTAAGGTTAGG -3'
(R):5'- AGAGGATGCTGCGTCTTCAACTC -3'
Posted On 2020-07-13