Incidental Mutation 'R8182:Irx6'
ID 634682
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene Name Iroquois homeobox 6
Synonyms
MMRRC Submission 067606-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 93400917-93407584 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 93403642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000034185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
AlphaFold Q9ER75
Predicted Effect probably null
Transcript: ENSMUST00000034185
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: Y122*

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167261
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: Y122*

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,272,774 (GRCm39) V1328A probably benign Het
Akna T C 4: 63,313,034 (GRCm39) Y363C probably damaging Het
Aph1c A G 9: 66,740,549 (GRCm39) I59T possibly damaging Het
Bbs7 A T 3: 36,664,372 (GRCm39) F100I probably damaging Het
Cibar1 T C 4: 12,171,842 (GRCm39) H30R probably benign Het
Eef2k G A 7: 120,472,626 (GRCm39) R113Q probably damaging Het
Fam221b G A 4: 43,660,342 (GRCm39) R416C probably damaging Het
Fam98b C A 2: 117,080,302 (GRCm39) D18E probably damaging Het
Fat2 T A 11: 55,175,223 (GRCm39) Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,526,861 (GRCm39) Q221L possibly damaging Het
Fbxo4 T C 15: 3,998,451 (GRCm39) R336G probably damaging Het
Fbxw15 A T 9: 109,384,778 (GRCm39) C341S probably benign Het
Fip1l1 T C 5: 74,748,813 (GRCm39) S398P probably damaging Het
Fsip2 A G 2: 82,806,951 (GRCm39) D1090G probably damaging Het
Fyb1 T A 15: 6,681,293 (GRCm39) M706K probably benign Het
Glg1 A T 8: 111,897,929 (GRCm39) F747I possibly damaging Het
Gm8257 A G 14: 44,887,623 (GRCm39) L254P probably benign Het
Hnf4g T C 3: 3,716,679 (GRCm39) Y283H possibly damaging Het
Jph4 C T 14: 55,347,213 (GRCm39) G445R possibly damaging Het
Kif16b G T 2: 142,554,819 (GRCm39) R660S possibly damaging Het
Kif21a C T 15: 90,819,964 (GRCm39) G1556D possibly damaging Het
Kif3a T A 11: 53,485,133 (GRCm39) Y531* probably null Het
Lrp2 T C 2: 69,319,673 (GRCm39) D1950G probably damaging Het
Med23 T G 10: 24,788,705 (GRCm39) S1371A probably benign Het
Mef2a T A 7: 66,917,875 (GRCm39) E112D probably benign Het
Mxra8 C G 4: 155,925,589 (GRCm39) Y99* probably null Het
Nbeal1 A G 1: 60,239,292 (GRCm39) T112A probably benign Het
Or8b49 G A 9: 38,505,840 (GRCm39) V108I probably benign Het
Pclo G A 5: 14,905,634 (GRCm39) E4955K unknown Het
Poc1b T C 10: 98,991,005 (GRCm39) probably null Het
Ptbp2 A G 3: 119,534,078 (GRCm39) Y264H probably damaging Het
Rhobtb2 A G 14: 70,034,070 (GRCm39) V385A probably benign Het
Rlf G A 4: 121,008,102 (GRCm39) P403S possibly damaging Het
Rnase9 T C 14: 51,276,537 (GRCm39) N147S probably benign Het
Serpinb9f A G 13: 33,518,603 (GRCm39) I368V probably benign Het
Slc1a1 A T 19: 28,878,848 (GRCm39) T196S probably benign Het
Smarca2 A G 19: 26,608,120 (GRCm39) S60G probably benign Het
Tbc1d4 A T 14: 101,744,990 (GRCm39) V212E probably damaging Het
Thap12 T A 7: 98,365,584 (GRCm39) I584N probably damaging Het
Ube3b T A 5: 114,530,199 (GRCm39) N195K possibly damaging Het
Upk3b T C 5: 136,067,982 (GRCm39) C58R probably damaging Het
Ush1c A G 7: 45,847,775 (GRCm39) probably null Het
Vmn1r60 T C 7: 5,547,876 (GRCm39) T75A Het
Vmn2r77 T A 7: 86,460,801 (GRCm39) L709H probably damaging Het
Wdcp T C 12: 4,901,850 (GRCm39) S569P probably damaging Het
Zfp418 A T 7: 7,184,658 (GRCm39) N207I probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp808 G A 13: 62,319,521 (GRCm39) C250Y probably damaging Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 93,402,717 (GRCm39) nonsense probably null
IGL02308:Irx6 APN 8 93,403,659 (GRCm39) missense probably damaging 1.00
R0308:Irx6 UTSW 8 93,403,659 (GRCm39) missense probably damaging 1.00
R1191:Irx6 UTSW 8 93,403,580 (GRCm39) missense probably damaging 1.00
R1251:Irx6 UTSW 8 93,404,881 (GRCm39) missense possibly damaging 0.87
R4161:Irx6 UTSW 8 93,402,919 (GRCm39) missense possibly damaging 0.78
R4368:Irx6 UTSW 8 93,405,029 (GRCm39) missense probably damaging 1.00
R4924:Irx6 UTSW 8 93,404,981 (GRCm39) missense probably benign 0.25
R4950:Irx6 UTSW 8 93,405,428 (GRCm39) missense probably damaging 1.00
R5425:Irx6 UTSW 8 93,404,145 (GRCm39) critical splice donor site probably null
R6455:Irx6 UTSW 8 93,402,700 (GRCm39) missense probably benign 0.04
R6969:Irx6 UTSW 8 93,403,958 (GRCm39) missense probably damaging 1.00
R7019:Irx6 UTSW 8 93,405,362 (GRCm39) missense probably damaging 0.99
R7128:Irx6 UTSW 8 93,403,994 (GRCm39) missense probably damaging 1.00
R7133:Irx6 UTSW 8 93,405,041 (GRCm39) missense probably damaging 1.00
R8546:Irx6 UTSW 8 93,405,264 (GRCm39) missense probably benign 0.19
R8955:Irx6 UTSW 8 93,405,040 (GRCm39) missense probably damaging 1.00
Z1176:Irx6 UTSW 8 93,404,999 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCCAGCATGGCATAGCAAATTC -3'
(R):5'- AGCACTGCTCAATTCCACTC -3'

Sequencing Primer
(F):5'- CATGGCATAGCAAATTCAAGGG -3'
(R):5'- GCAAACAGGGGCTCAGATTCC -3'
Posted On 2020-07-13