Incidental Mutation 'R8182:Irx6'
ID 634682
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene Name Iroquois homeobox 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 92674288-92680956 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 92677014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000034185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
AlphaFold Q9ER75
Predicted Effect probably null
Transcript: ENSMUST00000034185
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: Y122*

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167261
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: Y122*

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 92676089 nonsense probably null
IGL02308:Irx6 APN 8 92677031 missense probably damaging 1.00
R0308:Irx6 UTSW 8 92677031 missense probably damaging 1.00
R1191:Irx6 UTSW 8 92676952 missense probably damaging 1.00
R1251:Irx6 UTSW 8 92678253 missense possibly damaging 0.87
R4161:Irx6 UTSW 8 92676291 missense possibly damaging 0.78
R4368:Irx6 UTSW 8 92678401 missense probably damaging 1.00
R4924:Irx6 UTSW 8 92678353 missense probably benign 0.25
R4950:Irx6 UTSW 8 92678800 missense probably damaging 1.00
R5425:Irx6 UTSW 8 92677517 critical splice donor site probably null
R6455:Irx6 UTSW 8 92676072 missense probably benign 0.04
R6969:Irx6 UTSW 8 92677330 missense probably damaging 1.00
R7019:Irx6 UTSW 8 92678734 missense probably damaging 0.99
R7128:Irx6 UTSW 8 92677366 missense probably damaging 1.00
R7133:Irx6 UTSW 8 92678413 missense probably damaging 1.00
R8546:Irx6 UTSW 8 92678636 missense probably benign 0.19
R8955:Irx6 UTSW 8 92678412 missense probably damaging 1.00
Z1176:Irx6 UTSW 8 92678371 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCCAGCATGGCATAGCAAATTC -3'
(R):5'- AGCACTGCTCAATTCCACTC -3'

Sequencing Primer
(F):5'- CATGGCATAGCAAATTCAAGGG -3'
(R):5'- GCAAACAGGGGCTCAGATTCC -3'
Posted On 2020-07-13