Incidental Mutation 'R8182:Glg1'
ID 634683
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms MG160, CFR-1, MG-160, Selel, ESL-1, CFR
MMRRC Submission 067606-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.361) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111881053-111985848 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111897929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 747 (F747I)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably benign
Transcript: ENSMUST00000003404
AA Change: F736I

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: F736I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168741
AA Change: F140I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: F140I

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169020
AA Change: F747I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: F747I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,272,774 (GRCm39) V1328A probably benign Het
Akna T C 4: 63,313,034 (GRCm39) Y363C probably damaging Het
Aph1c A G 9: 66,740,549 (GRCm39) I59T possibly damaging Het
Bbs7 A T 3: 36,664,372 (GRCm39) F100I probably damaging Het
Cibar1 T C 4: 12,171,842 (GRCm39) H30R probably benign Het
Eef2k G A 7: 120,472,626 (GRCm39) R113Q probably damaging Het
Fam221b G A 4: 43,660,342 (GRCm39) R416C probably damaging Het
Fam98b C A 2: 117,080,302 (GRCm39) D18E probably damaging Het
Fat2 T A 11: 55,175,223 (GRCm39) Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,526,861 (GRCm39) Q221L possibly damaging Het
Fbxo4 T C 15: 3,998,451 (GRCm39) R336G probably damaging Het
Fbxw15 A T 9: 109,384,778 (GRCm39) C341S probably benign Het
Fip1l1 T C 5: 74,748,813 (GRCm39) S398P probably damaging Het
Fsip2 A G 2: 82,806,951 (GRCm39) D1090G probably damaging Het
Fyb1 T A 15: 6,681,293 (GRCm39) M706K probably benign Het
Gm8257 A G 14: 44,887,623 (GRCm39) L254P probably benign Het
Hnf4g T C 3: 3,716,679 (GRCm39) Y283H possibly damaging Het
Irx6 C A 8: 93,403,642 (GRCm39) Y122* probably null Het
Jph4 C T 14: 55,347,213 (GRCm39) G445R possibly damaging Het
Kif16b G T 2: 142,554,819 (GRCm39) R660S possibly damaging Het
Kif21a C T 15: 90,819,964 (GRCm39) G1556D possibly damaging Het
Kif3a T A 11: 53,485,133 (GRCm39) Y531* probably null Het
Lrp2 T C 2: 69,319,673 (GRCm39) D1950G probably damaging Het
Med23 T G 10: 24,788,705 (GRCm39) S1371A probably benign Het
Mef2a T A 7: 66,917,875 (GRCm39) E112D probably benign Het
Mxra8 C G 4: 155,925,589 (GRCm39) Y99* probably null Het
Nbeal1 A G 1: 60,239,292 (GRCm39) T112A probably benign Het
Or8b49 G A 9: 38,505,840 (GRCm39) V108I probably benign Het
Pclo G A 5: 14,905,634 (GRCm39) E4955K unknown Het
Poc1b T C 10: 98,991,005 (GRCm39) probably null Het
Ptbp2 A G 3: 119,534,078 (GRCm39) Y264H probably damaging Het
Rhobtb2 A G 14: 70,034,070 (GRCm39) V385A probably benign Het
Rlf G A 4: 121,008,102 (GRCm39) P403S possibly damaging Het
Rnase9 T C 14: 51,276,537 (GRCm39) N147S probably benign Het
Serpinb9f A G 13: 33,518,603 (GRCm39) I368V probably benign Het
Slc1a1 A T 19: 28,878,848 (GRCm39) T196S probably benign Het
Smarca2 A G 19: 26,608,120 (GRCm39) S60G probably benign Het
Tbc1d4 A T 14: 101,744,990 (GRCm39) V212E probably damaging Het
Thap12 T A 7: 98,365,584 (GRCm39) I584N probably damaging Het
Ube3b T A 5: 114,530,199 (GRCm39) N195K possibly damaging Het
Upk3b T C 5: 136,067,982 (GRCm39) C58R probably damaging Het
Ush1c A G 7: 45,847,775 (GRCm39) probably null Het
Vmn1r60 T C 7: 5,547,876 (GRCm39) T75A Het
Vmn2r77 T A 7: 86,460,801 (GRCm39) L709H probably damaging Het
Wdcp T C 12: 4,901,850 (GRCm39) S569P probably damaging Het
Zfp418 A T 7: 7,184,658 (GRCm39) N207I probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp808 G A 13: 62,319,521 (GRCm39) C250Y probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111,886,481 (GRCm39) missense probably damaging 1.00
IGL01326:Glg1 APN 8 111,909,205 (GRCm39) missense probably damaging 0.96
IGL01558:Glg1 APN 8 111,914,362 (GRCm39) missense probably benign 0.00
IGL01798:Glg1 APN 8 111,919,332 (GRCm39) missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111,887,359 (GRCm39) missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111,926,803 (GRCm39) missense probably damaging 1.00
IGL03374:Glg1 APN 8 111,889,412 (GRCm39) missense probably damaging 1.00
IGL03404:Glg1 APN 8 111,886,534 (GRCm39) missense probably damaging 1.00
diabolical UTSW 8 111,895,375 (GRCm39) missense probably damaging 1.00
BB007:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111,985,431 (GRCm39) missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111,892,214 (GRCm39) missense probably damaging 1.00
R0047:Glg1 UTSW 8 111,892,214 (GRCm39) missense probably damaging 1.00
R0255:Glg1 UTSW 8 111,886,490 (GRCm39) missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111,909,201 (GRCm39) missense probably damaging 1.00
R0458:Glg1 UTSW 8 111,887,238 (GRCm39) splice site probably benign
R0635:Glg1 UTSW 8 111,890,396 (GRCm39) splice site probably benign
R0765:Glg1 UTSW 8 111,886,429 (GRCm39) critical splice donor site probably null
R1104:Glg1 UTSW 8 111,924,235 (GRCm39) missense probably benign 0.01
R1495:Glg1 UTSW 8 111,924,307 (GRCm39) missense probably damaging 1.00
R1747:Glg1 UTSW 8 111,924,305 (GRCm39) missense probably damaging 1.00
R1899:Glg1 UTSW 8 111,892,306 (GRCm39) missense probably benign 0.23
R1950:Glg1 UTSW 8 111,892,271 (GRCm39) missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111,895,303 (GRCm39) missense probably damaging 1.00
R2112:Glg1 UTSW 8 111,919,178 (GRCm39) missense probably damaging 1.00
R2275:Glg1 UTSW 8 111,895,353 (GRCm39) nonsense probably null
R2342:Glg1 UTSW 8 111,914,439 (GRCm39) nonsense probably null
R4633:Glg1 UTSW 8 111,904,276 (GRCm39) critical splice donor site probably null
R4716:Glg1 UTSW 8 111,887,407 (GRCm39) nonsense probably null
R4732:Glg1 UTSW 8 111,914,387 (GRCm39) missense probably damaging 1.00
R4733:Glg1 UTSW 8 111,914,387 (GRCm39) missense probably damaging 1.00
R5594:Glg1 UTSW 8 111,914,513 (GRCm39) missense probably damaging 1.00
R5722:Glg1 UTSW 8 111,896,194 (GRCm39) missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111,892,323 (GRCm39) missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111,985,736 (GRCm39) missense probably benign 0.01
R6090:Glg1 UTSW 8 111,907,667 (GRCm39) missense probably damaging 1.00
R6476:Glg1 UTSW 8 111,926,806 (GRCm39) missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111,924,338 (GRCm39) missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111,914,513 (GRCm39) missense probably damaging 1.00
R7116:Glg1 UTSW 8 111,905,589 (GRCm39) missense probably benign 0.22
R7293:Glg1 UTSW 8 111,895,375 (GRCm39) missense probably damaging 1.00
R7431:Glg1 UTSW 8 111,887,386 (GRCm39) missense unknown
R7479:Glg1 UTSW 8 111,924,367 (GRCm39) missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111,985,675 (GRCm39) missense probably benign 0.04
R7547:Glg1 UTSW 8 111,914,393 (GRCm39) missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111,905,497 (GRCm39) missense probably benign 0.19
R7930:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
R8383:Glg1 UTSW 8 111,896,194 (GRCm39) missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111,888,114 (GRCm39) missense probably damaging 0.99
R8905:Glg1 UTSW 8 111,884,668 (GRCm39) missense probably damaging 0.99
R8954:Glg1 UTSW 8 111,914,527 (GRCm39) missense probably damaging 1.00
R8958:Glg1 UTSW 8 111,899,116 (GRCm39) nonsense probably null
R9023:Glg1 UTSW 8 111,904,380 (GRCm39) missense probably damaging 0.99
R9113:Glg1 UTSW 8 111,887,452 (GRCm39) intron probably benign
R9359:Glg1 UTSW 8 111,914,425 (GRCm39) missense probably benign 0.08
R9403:Glg1 UTSW 8 111,914,425 (GRCm39) missense probably benign 0.08
R9553:Glg1 UTSW 8 111,926,770 (GRCm39) missense probably benign 0.04
R9622:Glg1 UTSW 8 111,899,133 (GRCm39) missense probably damaging 1.00
R9714:Glg1 UTSW 8 111,924,301 (GRCm39) missense probably damaging 1.00
X0027:Glg1 UTSW 8 111,896,232 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGACTGTAGGCAGCTG -3'
(R):5'- GATGTGAGATCTCAGCAGACTATG -3'

Sequencing Primer
(F):5'- TGGCAATGGTCTGGCAGAC -3'
(R):5'- CTCCCAAGTGCTGTTGTCAAGG -3'
Posted On 2020-07-13