Mutagenetix > Incidental Mutations

Incidental Mutation 'R8182:Olfr913'

634684

Institutional Source

Beutler Lab

Gene Symbol

Olfr913

Ensembl Gene

ENSMUSG00000059189

Gene Name

olfactory receptor 913

Synonyms

MOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R8182 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38592759-38596283 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38594544 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 108 (V108I)

Ref Sequence

ENSEMBL: ENSMUSP00000079876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081095]

Predicted Effect

probably benign
Transcript: ENSMUST00000081095
AA Change: V108I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: V108I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.6e-49	PFAM
Pfam:7tm_1	41	290	3.9e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	A	G	8: 13,222,774	V1328A	probably benign	Het
Akna	T	C	4: 63,394,797	Y363C	probably damaging	Het
Aph1c	A	G	9: 66,833,267	I59T	possibly damaging	Het
Bbs7	A	T	3: 36,610,223	F100I	probably damaging	Het
BC068281	T	C	12: 4,851,850	S569P	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Eef2k	G	A	7: 120,873,403	R113Q	probably damaging	Het
Fam221b	G	A	4: 43,660,342	R416C	probably damaging	Het
Fam92a	T	C	4: 12,171,842	H30R	probably benign	Het
Fam98b	C	A	2: 117,249,821	D18E	probably damaging	Het
Fat2	T	A	11: 55,284,397	Y1830F	possibly damaging	Het
Fbrsl1	T	A	5: 110,378,995	Q221L	possibly damaging	Het
Fbxo4	T	C	15: 3,968,969	R336G	probably damaging	Het
Fbxw15	A	T	9: 109,555,710	C341S	probably benign	Het
Fip1l1	T	C	5: 74,588,152	S398P	probably damaging	Het
Fsip2	A	G	2: 82,976,607	D1090G	probably damaging	Het
Fyb	T	A	15: 6,651,812	M706K	probably benign	Het
Glg1	A	T	8: 111,171,297	F747I	possibly damaging	Het
Gm8257	A	G	14: 44,650,166	L254P	probably benign	Het
Hnf4g	T	C	3: 3,651,619	Y283H	possibly damaging	Het
Irx6	C	A	8: 92,677,014	Y122*	probably null	Het
Jph4	C	T	14: 55,109,756	G445R	possibly damaging	Het
Kif16b	G	T	2: 142,712,899	R660S	possibly damaging	Het
Kif21a	C	T	15: 90,935,761	G1556D	possibly damaging	Het
Kif3a	T	A	11: 53,594,306	Y531*	probably null	Het
Lrp2	T	C	2: 69,489,329	D1950G	probably damaging	Het
Med23	T	G	10: 24,912,807	S1371A	probably benign	Het
Mef2a	T	A	7: 67,268,127	E112D	probably benign	Het
Mxra8	C	G	4: 155,841,132	Y99*	probably null	Het
Nbeal1	A	G	1: 60,200,133	T112A	probably benign	Het
Pclo	G	A	5: 14,855,620	E4955K	unknown	Het
Poc1b	T	C	10: 99,155,143		probably null	Het
Prkrir	T	A	7: 98,716,377	I584N	probably damaging	Het
Ptbp2	A	G	3: 119,740,429	Y264H	probably damaging	Het
Rhobtb2	A	G	14: 69,796,621	V385A	probably benign	Het
Rlf	G	A	4: 121,150,905	P403S	possibly damaging	Het
Rnase9	T	C	14: 51,039,080	N147S	probably benign	Het
Serpinb9f	A	G	13: 33,334,620	I368V	probably benign	Het
Slc1a1	A	T	19: 28,901,448	T196S	probably benign	Het
Smarca2	A	G	19: 26,630,720	S60G	probably benign	Het
Tbc1d4	A	T	14: 101,507,554	V212E	probably damaging	Het
Ube3b	T	A	5: 114,392,138	N195K	possibly damaging	Het
Upk3b	T	C	5: 136,039,128	C58R	probably damaging	Het
Ush1c	A	G	7: 46,198,351		probably null	Het
Vmn1r60	T	C	7: 5,544,877	T75A		Het
Vmn2r77	T	A	7: 86,811,593	L709H	probably damaging	Het
Zfp418	A	T	7: 7,181,659	N207I	probably benign	Het
Zfp808	G	A	13: 62,171,707	C250Y	probably damaging	Het

Other mutations in Olfr913

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Olfr913	APN	9	38594905	missense	probably damaging	0.98
IGL02028:Olfr913	APN	9	38594419	nonsense	probably null
IGL02256:Olfr913	APN	9	38594544	missense	probably benign	0.01
IGL03103:Olfr913	APN	9	38594527	missense	probably damaging	1.00
IGL03297:Olfr913	APN	9	38594525	missense	probably benign	0.01
R2152:Olfr913	UTSW	9	38594411	missense	probably damaging	1.00
R2153:Olfr913	UTSW	9	38594411	missense	probably damaging	1.00
R2154:Olfr913	UTSW	9	38594411	missense	probably damaging	1.00
R3176:Olfr913	UTSW	9	38594643	missense	probably damaging	1.00
R3276:Olfr913	UTSW	9	38594643	missense	probably damaging	1.00
R4985:Olfr913	UTSW	9	38594362	missense	possibly damaging	0.88
R5043:Olfr913	UTSW	9	38594841	missense	probably damaging	1.00
R5871:Olfr913	UTSW	9	38594332	missense	possibly damaging	0.53
R6106:Olfr913	UTSW	9	38594956	missense	probably benign	0.11
R6583:Olfr913	UTSW	9	38594964	missense	possibly damaging	0.79
R6823:Olfr913	UTSW	9	38594905	missense	possibly damaging	0.89
R7472:Olfr913	UTSW	9	38594904	missense	probably benign	0.10
R7912:Olfr913	UTSW	9	38595150	missense	probably benign	0.25
R8036:Olfr913	UTSW	9	38594890	missense	probably benign	0.00
R8390:Olfr913	UTSW	9	38594591	nonsense	probably null
Z1177:Olfr913	UTSW	9	38594289	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGGGCTAAATTCTCACCTCC -3'
(R):5'- TGGTACAGGAGATTTGCAGC -3'

Sequencing Primer
(F):5'- CACACACCCATGTACTTTCTCTTG -3'
(R):5'- GGTATTTCCATCACAAAATGTCAGTC -3'

Posted On

2020-07-13