Incidental Mutation 'R8182:Olfr913'
ID634684
Institutional Source Beutler Lab
Gene Symbol Olfr913
Ensembl Gene ENSMUSG00000059189
Gene Nameolfactory receptor 913
SynonymsMOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8182 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38592759-38596283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38594544 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 108 (V108I)
Ref Sequence ENSEMBL: ENSMUSP00000079876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081095]
Predicted Effect probably benign
Transcript: ENSMUST00000081095
AA Change: V108I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: V108I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 3.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Olfr913
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr913 APN 9 38594905 missense probably damaging 0.98
IGL02028:Olfr913 APN 9 38594419 nonsense probably null
IGL02256:Olfr913 APN 9 38594544 missense probably benign 0.01
IGL03103:Olfr913 APN 9 38594527 missense probably damaging 1.00
IGL03297:Olfr913 APN 9 38594525 missense probably benign 0.01
R2152:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2153:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2154:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R3176:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R3276:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R4985:Olfr913 UTSW 9 38594362 missense possibly damaging 0.88
R5043:Olfr913 UTSW 9 38594841 missense probably damaging 1.00
R5871:Olfr913 UTSW 9 38594332 missense possibly damaging 0.53
R6106:Olfr913 UTSW 9 38594956 missense probably benign 0.11
R6583:Olfr913 UTSW 9 38594964 missense possibly damaging 0.79
R6823:Olfr913 UTSW 9 38594905 missense possibly damaging 0.89
R7472:Olfr913 UTSW 9 38594904 missense probably benign 0.10
R7912:Olfr913 UTSW 9 38595150 missense probably benign 0.25
R8036:Olfr913 UTSW 9 38594890 missense probably benign 0.00
R8390:Olfr913 UTSW 9 38594591 nonsense probably null
Z1177:Olfr913 UTSW 9 38594289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGGCTAAATTCTCACCTCC -3'
(R):5'- TGGTACAGGAGATTTGCAGC -3'

Sequencing Primer
(F):5'- CACACACCCATGTACTTTCTCTTG -3'
(R):5'- GGTATTTCCATCACAAAATGTCAGTC -3'
Posted On2020-07-13