Incidental Mutation 'R8182:Med23'
ID634687
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8182 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24912807 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1371 (S1371A)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: S1365A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: S1365A

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020161
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: S1371A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: S1371A

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
AA Change: S1005A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: S1005A

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Serpinb9f A G 13: 33,334,620 I368V probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTCTGCTTTTCCGTAATTG -3'
(R):5'- GAAACGCCCACATTCCTAGG -3'

Sequencing Primer
(F):5'- GTGCTCTCGCTTCTTAGGTAGAGAAG -3'
(R):5'- ACGCCCACATTCCTAGGGATTTG -3'
Posted On2020-07-13