Incidental Mutation 'R8182:Serpinb9f'
ID 634691
Institutional Source Beutler Lab
Gene Symbol Serpinb9f
Ensembl Gene ENSMUSG00000038327
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 9f
Synonyms NK21, ovalbumin, Spi13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8182 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 33324077-33335370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33334620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 368 (I368V)
Ref Sequence ENSEMBL: ENSMUSP00000074958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075515]
AlphaFold Q80UK5
Predicted Effect probably benign
Transcript: ENSMUST00000075515
AA Change: I368V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074958
Gene: ENSMUSG00000038327
AA Change: I368V

DomainStartEndE-ValueType
SERPIN 13 377 2.03e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 A G 8: 13,222,774 V1328A probably benign Het
Akna T C 4: 63,394,797 Y363C probably damaging Het
Aph1c A G 9: 66,833,267 I59T possibly damaging Het
Bbs7 A T 3: 36,610,223 F100I probably damaging Het
BC068281 T C 12: 4,851,850 S569P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eef2k G A 7: 120,873,403 R113Q probably damaging Het
Fam221b G A 4: 43,660,342 R416C probably damaging Het
Fam92a T C 4: 12,171,842 H30R probably benign Het
Fam98b C A 2: 117,249,821 D18E probably damaging Het
Fat2 T A 11: 55,284,397 Y1830F possibly damaging Het
Fbrsl1 T A 5: 110,378,995 Q221L possibly damaging Het
Fbxo4 T C 15: 3,968,969 R336G probably damaging Het
Fbxw15 A T 9: 109,555,710 C341S probably benign Het
Fip1l1 T C 5: 74,588,152 S398P probably damaging Het
Fsip2 A G 2: 82,976,607 D1090G probably damaging Het
Fyb T A 15: 6,651,812 M706K probably benign Het
Glg1 A T 8: 111,171,297 F747I possibly damaging Het
Gm8257 A G 14: 44,650,166 L254P probably benign Het
Hnf4g T C 3: 3,651,619 Y283H possibly damaging Het
Irx6 C A 8: 92,677,014 Y122* probably null Het
Jph4 C T 14: 55,109,756 G445R possibly damaging Het
Kif16b G T 2: 142,712,899 R660S possibly damaging Het
Kif21a C T 15: 90,935,761 G1556D possibly damaging Het
Kif3a T A 11: 53,594,306 Y531* probably null Het
Lrp2 T C 2: 69,489,329 D1950G probably damaging Het
Med23 T G 10: 24,912,807 S1371A probably benign Het
Mef2a T A 7: 67,268,127 E112D probably benign Het
Mxra8 C G 4: 155,841,132 Y99* probably null Het
Nbeal1 A G 1: 60,200,133 T112A probably benign Het
Olfr913 G A 9: 38,594,544 V108I probably benign Het
Pclo G A 5: 14,855,620 E4955K unknown Het
Poc1b T C 10: 99,155,143 probably null Het
Prkrir T A 7: 98,716,377 I584N probably damaging Het
Ptbp2 A G 3: 119,740,429 Y264H probably damaging Het
Rhobtb2 A G 14: 69,796,621 V385A probably benign Het
Rlf G A 4: 121,150,905 P403S possibly damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Slc1a1 A T 19: 28,901,448 T196S probably benign Het
Smarca2 A G 19: 26,630,720 S60G probably benign Het
Tbc1d4 A T 14: 101,507,554 V212E probably damaging Het
Ube3b T A 5: 114,392,138 N195K possibly damaging Het
Upk3b T C 5: 136,039,128 C58R probably damaging Het
Ush1c A G 7: 46,198,351 probably null Het
Vmn1r60 T C 7: 5,544,877 T75A Het
Vmn2r77 T A 7: 86,811,593 L709H probably damaging Het
Zfp418 A T 7: 7,181,659 N207I probably benign Het
Zfp808 G A 13: 62,171,707 C250Y probably damaging Het
Other mutations in Serpinb9f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Serpinb9f APN 13 33334468 missense probably damaging 1.00
IGL03272:Serpinb9f APN 13 33327916 missense probably damaging 1.00
R0112:Serpinb9f UTSW 13 33327951 splice site probably benign
R0254:Serpinb9f UTSW 13 33334591 missense probably damaging 1.00
R0498:Serpinb9f UTSW 13 33326007 splice site probably benign
R0711:Serpinb9f UTSW 13 33327921 missense probably damaging 1.00
R1004:Serpinb9f UTSW 13 33334242 critical splice acceptor site probably benign
R1913:Serpinb9f UTSW 13 33325846 missense probably damaging 1.00
R2214:Serpinb9f UTSW 13 33334609 missense probably benign 0.00
R3908:Serpinb9f UTSW 13 33327936 missense probably damaging 0.99
R6182:Serpinb9f UTSW 13 33334422 missense probably damaging 1.00
R6421:Serpinb9f UTSW 13 33334533 missense probably benign 0.01
R6965:Serpinb9f UTSW 13 33325876 missense possibly damaging 0.50
R7043:Serpinb9f UTSW 13 33325987 missense possibly damaging 0.85
R7406:Serpinb9f UTSW 13 33334560 nonsense probably null
R8234:Serpinb9f UTSW 13 33325915 missense probably benign
R8341:Serpinb9f UTSW 13 33327307 nonsense probably null
R8492:Serpinb9f UTSW 13 33334604 missense probably damaging 1.00
R8794:Serpinb9f UTSW 13 33329413 missense probably benign 0.15
R9433:Serpinb9f UTSW 13 33334255 missense probably benign 0.00
R9508:Serpinb9f UTSW 13 33334532 missense probably benign
X0019:Serpinb9f UTSW 13 33334534 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGAAGCAAGGCTGACTTATC -3'
(R):5'- AGAGCTGAATGTGGGCATC -3'

Sequencing Primer
(F):5'- AGGAAAACCTGTGTCTGTCC -3'
(R):5'- CTGAATGTGGGCATCACTAGATC -3'
Posted On 2020-07-13