Incidental Mutation 'R8183:Ifi203'
ID634707
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8183 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173928700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 506 (S506P)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: S506P
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: S506P

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T A 15: 73,119,488 K534* probably null Het
Art1 A T 7: 102,107,426 I275F probably damaging Het
Atp1a2 T C 1: 172,289,351 N233S probably damaging Het
B3gnt2 T A 11: 22,836,373 I272L probably benign Het
Bpifa1 A G 2: 154,146,119 Q194R possibly damaging Het
Cand2 A G 6: 115,791,918 E563G probably benign Het
Clns1a A G 7: 97,705,681 Y78C probably damaging Het
Col20a1 T C 2: 180,998,414 V483A Het
Col3a1 C G 1: 45,334,810 P621R unknown Het
Cst9 G A 2: 148,836,714 R88H possibly damaging Het
Cxxc1 T C 18: 74,220,357 Y513H probably damaging Het
Dcdc2a T C 13: 25,107,650 F206S possibly damaging Het
Dgkz C A 2: 91,939,592 G576C probably damaging Het
Dpy19l3 A G 7: 35,695,389 F575L probably damaging Het
Ftcd T A 10: 76,575,707 M1K probably null Het
Gtf2ird1 T C 5: 134,357,835 D1044G unknown Het
Gzmc A T 14: 56,232,707 M111K probably damaging Het
Hpse T A 5: 100,685,118 Y437F probably damaging Het
Igsf10 A T 3: 59,330,615 I715K probably benign Het
Inadl A C 4: 98,674,229 E1534D probably damaging Het
Ints9 T C 14: 65,036,453 V569A probably damaging Het
Itih3 A G 14: 30,909,476 F821S probably benign Het
Kcnh7 T C 2: 62,702,977 H1186R probably damaging Het
Krt33a A G 11: 100,014,749 probably null Het
Lonrf1 A T 8: 36,222,665 M718K possibly damaging Het
Mefv C T 16: 3,708,582 R756K possibly damaging Het
Metap1d T A 2: 71,506,863 F40Y possibly damaging Het
Myh1 A T 11: 67,202,006 D42V possibly damaging Het
Nsd1 T C 13: 55,312,373 S2241P probably damaging Het
Olfr1495 T A 19: 13,768,722 Y127N probably damaging Het
Osbpl3 C A 6: 50,303,109 R710L probably benign Het
Osbpl6 C T 2: 76,585,060 R589C probably damaging Het
Pam T C 1: 97,834,474 T795A probably benign Het
Plscr5 A G 9: 92,198,602 Q47R probably benign Het
Sec23b G T 2: 144,559,269 V17L probably benign Het
Serpina3j C A 12: 104,318,495 Y310* probably null Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo3 A T 6: 29,558,759 M724K probably damaging Het
Trappc11 T G 8: 47,529,356 E116A possibly damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trrap T G 5: 144,828,533 S2501A probably benign Het
Ubr4 T G 4: 139,482,471 S5005A unknown Het
Urah A T 7: 140,836,794 Q60L probably benign Het
Vmn2r28 A T 7: 5,488,148 C367S probably damaging Het
Zmym1 T C 4: 127,058,856 D44G probably benign Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCCGAGGTGCTTGGAATATC -3'
(R):5'- AGAAACATCTCTGTCACACAGG -3'

Sequencing Primer
(F):5'- GCTTGGAATATCGTGCATGC -3'
(R):5'- ACATCTCTGTCACACAGGTACCTC -3'
Posted On2020-07-13