Mutagenetix > Incidental Mutations

Incidental Mutation 'V1662:Arfgef1'

63471

Institutional Source

Beutler Lab

Gene Symbol

Arfgef1

Ensembl Gene

ENSMUSG00000067851

Gene Name

ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)

Synonyms

P200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik

Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V1662 () of strain 633

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

10137571-10232670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10173253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1024 (K1024E)

Ref Sequence

ENSEMBL: ENSMUSP00000085986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]

AlphaFold

G3X9K3

Predicted Effect

probably damaging
Transcript: ENSMUST00000088615
AA Change: K1024E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: K1024E

Domain	Start	End	E-Value	Type
Pfam:DCB	28	213	5.2e-45	PFAM
low complexity region	221	233	N/A	INTRINSIC
low complexity region	291	306	N/A	INTRINSIC
Pfam:Sec7_N	416	575	1.3e-52	PFAM
Blast:Sec7	588	637	6e-24	BLAST
low complexity region	661	681	N/A	INTRINSIC
Sec7	692	879	1.15e-105	SMART
Blast:Sec7	897	933	6e-13	BLAST
Blast:Sec7	947	986	8e-18	BLAST
Pfam:DUF1981	1217	1300	3.6e-39	PFAM
low complexity region	1587	1602	N/A	INTRINSIC
low complexity region	1777	1782	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000131556
AA Change: K1024E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: K1024E

Domain	Start	End	E-Value	Type
coiled coil region	207	234	N/A	INTRINSIC
low complexity region	291	306	N/A	INTRINSIC
Pfam:Sec7_N	413	576	3.1e-59	PFAM
Blast:Sec7	588	637	2e-24	BLAST
low complexity region	661	681	N/A	INTRINSIC
Sec7	692	879	1.15e-105	SMART
Blast:Sec7	897	933	3e-13	BLAST
Blast:Sec7	947	986	2e-18	BLAST

Meta Mutation Damage Score

0.4052

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Amph	G	A	13: 19,139,370	V601M	probably benign	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cacna1h	T	C	17: 25,377,309	N1913D	possibly damaging	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
Cfap44	C	A	16: 44,449,138	Y1168*	probably null	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Itgav	C	T	2: 83,783,854	R519W	possibly damaging	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Pyroxd1	G	A	6: 142,358,443	G307S	probably damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Arfgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arfgef1	APN	1	10199787	missense	probably benign
IGL00919:Arfgef1	APN	1	10173237	missense	probably damaging	1.00
IGL01022:Arfgef1	APN	1	10174076	missense	probably damaging	1.00
IGL01155:Arfgef1	APN	1	10198982	splice site	probably benign
IGL01288:Arfgef1	APN	1	10213211	missense	possibly damaging	0.67
IGL01397:Arfgef1	APN	1	10159571	missense	probably benign	0.40
IGL01433:Arfgef1	APN	1	10153432	missense	probably damaging	1.00
IGL01653:Arfgef1	APN	1	10159908	nonsense	probably null
IGL01669:Arfgef1	APN	1	10159615	missense	probably damaging	1.00
IGL01795:Arfgef1	APN	1	10147528	missense	probably benign	0.01
IGL01860:Arfgef1	APN	1	10154396	missense	probably damaging	1.00
IGL02137:Arfgef1	APN	1	10213113	missense	probably damaging	1.00
IGL02365:Arfgef1	APN	1	10199883	missense	probably benign	0.00
IGL02519:Arfgef1	APN	1	10209668	missense	probably benign	0.13
IGL02542:Arfgef1	APN	1	10172842	missense	probably benign	0.24
IGL02604:Arfgef1	APN	1	10181050	splice site	probably benign
IGL02743:Arfgef1	APN	1	10199829	missense	probably benign	0.00
IGL03225:Arfgef1	APN	1	10154318	missense	probably damaging	1.00
Collected	UTSW	1	10180938	missense	probably damaging	1.00
uncle_joe	UTSW	1	10160835	missense	probably damaging	1.00
G1Funyon:Arfgef1	UTSW	1	10179833	missense	probably damaging	1.00
I2288:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
I2289:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
R0383:Arfgef1	UTSW	1	10198842	critical splice donor site	probably null
R0491:Arfgef1	UTSW	1	10179987	splice site	probably benign
R0636:Arfgef1	UTSW	1	10199851	missense	probably benign
R1006:Arfgef1	UTSW	1	10140481	missense	probably benign	0.00
R1212:Arfgef1	UTSW	1	10216559	missense	probably benign	0.05
R1233:Arfgef1	UTSW	1	10184090	missense	probably damaging	1.00
R1346:Arfgef1	UTSW	1	10159733	missense	probably benign	0.41
R1416:Arfgef1	UTSW	1	10172939	missense	probably damaging	1.00
R1477:Arfgef1	UTSW	1	10189284	missense	probably damaging	1.00
R1581:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R1587:Arfgef1	UTSW	1	10159959	missense	probably damaging	0.99
R1602:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1745:Arfgef1	UTSW	1	10173255	missense	probably damaging	1.00
R1831:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1832:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1833:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1918:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R1919:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2059:Arfgef1	UTSW	1	10188752	splice site	probably null
R2146:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2148:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2149:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2150:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2373:Arfgef1	UTSW	1	10174142	missense	probably damaging	1.00
R2516:Arfgef1	UTSW	1	10153654	missense	possibly damaging	0.89
R3863:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3916:Arfgef1	UTSW	1	10189443	missense	probably benign	0.01
R3948:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3949:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3977:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R3978:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R3979:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R4086:Arfgef1	UTSW	1	10163759	missense	probably benign	0.06
R4175:Arfgef1	UTSW	1	10159636	missense	probably damaging	1.00
R4257:Arfgef1	UTSW	1	10159546	intron	probably benign
R4572:Arfgef1	UTSW	1	10213141	missense	probably damaging	1.00
R4652:Arfgef1	UTSW	1	10173262	missense	probably damaging	0.98
R4678:Arfgef1	UTSW	1	10142666	missense	probably benign	0.03
R4737:Arfgef1	UTSW	1	10189611	missense	possibly damaging	0.85
R4779:Arfgef1	UTSW	1	10153733	missense	probably damaging	1.00
R4818:Arfgef1	UTSW	1	10216547	missense	probably benign
R4898:Arfgef1	UTSW	1	10159573	missense	possibly damaging	0.75
R4979:Arfgef1	UTSW	1	10213109	missense	probably damaging	1.00
R5039:Arfgef1	UTSW	1	10199736	missense	probably benign	0.37
R5194:Arfgef1	UTSW	1	10204907	missense	probably benign	0.09
R5428:Arfgef1	UTSW	1	10160835	missense	probably damaging	1.00
R5533:Arfgef1	UTSW	1	10199727	critical splice donor site	probably null
R5547:Arfgef1	UTSW	1	10160976	missense	probably damaging	1.00
R5562:Arfgef1	UTSW	1	10144746	missense	probably damaging	1.00
R5635:Arfgef1	UTSW	1	10188860	missense	possibly damaging	0.81
R5697:Arfgef1	UTSW	1	10160838	missense	probably benign	0.03
R5704:Arfgef1	UTSW	1	10159583	missense	probably damaging	0.98
R5722:Arfgef1	UTSW	1	10138884	missense	probably benign	0.04
R5793:Arfgef1	UTSW	1	10209528	missense	probably benign	0.01
R5835:Arfgef1	UTSW	1	10160739	missense	probably damaging	1.00
R5870:Arfgef1	UTSW	1	10180938	missense	probably damaging	1.00
R5990:Arfgef1	UTSW	1	10172921	missense	probably damaging	0.99
R6290:Arfgef1	UTSW	1	10188811	missense	possibly damaging	0.91
R6460:Arfgef1	UTSW	1	10213060	missense	probably damaging	1.00
R6613:Arfgef1	UTSW	1	10194396	missense	possibly damaging	0.95
R6802:Arfgef1	UTSW	1	10189452	missense	probably benign	0.35
R6967:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6967:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6968:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6968:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6969:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6969:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6970:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6970:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R7092:Arfgef1	UTSW	1	10153676	missense	probably damaging	1.00
R7251:Arfgef1	UTSW	1	10198975	missense	possibly damaging	0.81
R7334:Arfgef1	UTSW	1	10184460	missense	probably damaging	1.00
R7399:Arfgef1	UTSW	1	10180897	missense	probably benign	0.00
R7631:Arfgef1	UTSW	1	10232469	missense	probably benign	0.00
R7699:Arfgef1	UTSW	1	10194411	missense	possibly damaging	0.78
R7700:Arfgef1	UTSW	1	10194411	missense	possibly damaging	0.78
R7772:Arfgef1	UTSW	1	10157010	missense	possibly damaging	0.96
R7968:Arfgef1	UTSW	1	10172920	missense	probably damaging	1.00
R8195:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
R8292:Arfgef1	UTSW	1	10156969	missense	probably benign	0.06
R8301:Arfgef1	UTSW	1	10179833	missense	probably damaging	1.00
R8341:Arfgef1	UTSW	1	10154328	missense	probably benign	0.37
R8410:Arfgef1	UTSW	1	10159642	missense	possibly damaging	0.94
R8411:Arfgef1	UTSW	1	10216534	missense	probably benign	0.01
R8793:Arfgef1	UTSW	1	10142607	missense	possibly damaging	0.95
R8903:Arfgef1	UTSW	1	10141613	missense	probably damaging	1.00
R8955:Arfgef1	UTSW	1	10199837	missense	probably benign	0.25
R9036:Arfgef1	UTSW	1	10188830	missense	probably benign	0.01
R9185:Arfgef1	UTSW	1	10144779	missense	probably damaging	1.00
R9252:Arfgef1	UTSW	1	10172897	nonsense	probably null
R9335:Arfgef1	UTSW	1	10158011	missense	probably damaging	1.00
R9348:Arfgef1	UTSW	1	10213194	missense	probably benign	0.03
R9355:Arfgef1	UTSW	1	10199775	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCACTTCAGGATCTACAGCACAGAAA -3'
(R):5'- GAATTGTCGGTTCAGGTTGTGTCTAGAA -3'

Sequencing Primer
(F):5'- TCTACAGCACAGAAAGAAAAAAAAAG -3'
(R):5'- AGCGCATAGACAGTTGGTTTAC -3'

Posted On

2013-07-30