Mutagenetix > Incidental Mutation

Incidental Mutation 'R8183:Trrap'

634722

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

067781-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144704547-144796588 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 144765343 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 2501 (S2501A)

Ref Sequence

ENSEMBL: ENSMUSP00000098035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038980
AA Change: S2501A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: S2501A

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094120
AA Change: S2519A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: S2519A

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100467
AA Change: S2501A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: S2501A

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: S2240A

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213013
AA Change: S2520A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago2	T	A	15: 72,991,337 (GRCm39)	K534*	probably null	Het
Art1	A	T	7: 101,756,633 (GRCm39)	I275F	probably damaging	Het
Atp1a2	T	C	1: 172,116,918 (GRCm39)	N233S	probably damaging	Het
B3gnt2	T	A	11: 22,786,373 (GRCm39)	I272L	probably benign	Het
Bpifa1	A	G	2: 153,988,039 (GRCm39)	Q194R	possibly damaging	Het
Cand2	A	G	6: 115,768,879 (GRCm39)	E563G	probably benign	Het
Clns1a	A	G	7: 97,354,888 (GRCm39)	Y78C	probably damaging	Het
Col20a1	T	C	2: 180,640,207 (GRCm39)	V483A		Het
Col3a1	C	G	1: 45,373,970 (GRCm39)	P621R	unknown	Het
Cst9	G	A	2: 148,678,634 (GRCm39)	R88H	possibly damaging	Het
Cxxc1	T	C	18: 74,353,428 (GRCm39)	Y513H	probably damaging	Het
Dcdc2a	T	C	13: 25,291,633 (GRCm39)	F206S	possibly damaging	Het
Dgkz	C	A	2: 91,769,937 (GRCm39)	G576C	probably damaging	Het
Dpy19l3	A	G	7: 35,394,814 (GRCm39)	F575L	probably damaging	Het
Ftcd	T	A	10: 76,411,541 (GRCm39)	M1K	probably null	Het
Gtf2ird1	T	C	5: 134,386,689 (GRCm39)	D1044G	unknown	Het
Gzmc	A	T	14: 56,470,164 (GRCm39)	M111K	probably damaging	Het
Hpse	T	A	5: 100,832,984 (GRCm39)	Y437F	probably damaging	Het
Ifi203	A	G	1: 173,756,266 (GRCm39)	S506P	unknown	Het
Igsf10	A	T	3: 59,238,036 (GRCm39)	I715K	probably benign	Het
Ints9	T	C	14: 65,273,902 (GRCm39)	V569A	probably damaging	Het
Itih3	A	G	14: 30,631,433 (GRCm39)	F821S	probably benign	Het
Kcnh7	T	C	2: 62,533,321 (GRCm39)	H1186R	probably damaging	Het
Krt33a	A	G	11: 99,905,575 (GRCm39)		probably null	Het
Lonrf1	A	T	8: 36,689,819 (GRCm39)	M718K	possibly damaging	Het
Mefv	C	T	16: 3,526,446 (GRCm39)	R756K	possibly damaging	Het
Metap1d	T	A	2: 71,337,207 (GRCm39)	F40Y	possibly damaging	Het
Myh1	A	T	11: 67,092,832 (GRCm39)	D42V	possibly damaging	Het
Myo15b	T	G	11: 115,773,843 (GRCm39)		probably null	Het
Nsd1	T	C	13: 55,460,186 (GRCm39)	S2241P	probably damaging	Het
Or10q12	T	A	19: 13,746,086 (GRCm39)	Y127N	probably damaging	Het
Osbpl3	C	A	6: 50,280,089 (GRCm39)	R710L	probably benign	Het
Osbpl6	C	T	2: 76,415,404 (GRCm39)	R589C	probably damaging	Het
Pam	T	C	1: 97,762,199 (GRCm39)	T795A	probably benign	Het
Patj	A	C	4: 98,562,466 (GRCm39)	E1534D	probably damaging	Het
Plscr5	A	G	9: 92,080,655 (GRCm39)	Q47R	probably benign	Het
Ppil1	A	T	17: 29,481,053 (GRCm39)		probably null	Het
Sec23b	G	T	2: 144,401,189 (GRCm39)	V17L	probably benign	Het
Serpina3j	C	A	12: 104,284,754 (GRCm39)	Y310*	probably null	Het
Slc6a7	T	C	18: 61,140,448 (GRCm39)	S195G	probably null	Het
Snrpn	A	G	7: 59,634,830 (GRCm39)	Y168H	probably damaging	Het
Tmprss15	T	C	16: 78,884,400 (GRCm39)	D94G	probably benign	Het
Tnpo3	A	T	6: 29,558,758 (GRCm39)	M724K	probably damaging	Het
Trappc11	T	G	8: 47,982,391 (GRCm39)	E116A	possibly damaging	Het
Trpc6	T	C	9: 8,653,150 (GRCm39)	F652S	possibly damaging	Het
Ubr4	T	G	4: 139,209,782 (GRCm39)	S5005A	unknown	Het
Urah	A	T	7: 140,416,707 (GRCm39)	Q60L	probably benign	Het
Vmn2r28	A	T	7: 5,491,147 (GRCm39)	C367S	probably damaging	Het
Zmym1	T	C	4: 126,952,649 (GRCm39)	D44G	probably benign	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144,716,784 (GRCm39)	splice site	probably benign
IGL00470:Trrap	APN	5	144,754,848 (GRCm39)	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144,762,035 (GRCm39)	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144,721,065 (GRCm39)	splice site	probably benign
IGL01087:Trrap	APN	5	144,783,349 (GRCm39)	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144,741,628 (GRCm39)	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144,767,779 (GRCm39)	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144,767,831 (GRCm39)	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144,770,097 (GRCm39)	splice site	probably benign
IGL01748:Trrap	APN	5	144,770,150 (GRCm39)	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144,758,685 (GRCm39)	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144,793,799 (GRCm39)	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144,765,304 (GRCm39)	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144,753,243 (GRCm39)	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144,777,246 (GRCm39)	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144,769,348 (GRCm39)	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144,714,727 (GRCm39)	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144,735,200 (GRCm39)	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144,761,360 (GRCm39)	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144,777,889 (GRCm39)	splice site	probably benign
IGL02953:Trrap	APN	5	144,752,774 (GRCm39)	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144,769,996 (GRCm39)	missense	probably benign	0.00
Buffer	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
Card-tower	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
Cookie	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
Glass_house	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
Immovable	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
vitreous	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144,733,781 (GRCm39)	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144,765,410 (GRCm39)	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0112:Trrap	UTSW	5	144,759,571 (GRCm39)	nonsense	probably null
R0126:Trrap	UTSW	5	144,742,560 (GRCm39)	nonsense	probably null
R0257:Trrap	UTSW	5	144,741,045 (GRCm39)	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144,753,205 (GRCm39)	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144,753,149 (GRCm39)	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144,751,366 (GRCm39)	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144,776,377 (GRCm39)	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144,783,287 (GRCm39)	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144,790,309 (GRCm39)	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144,751,640 (GRCm39)	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144,714,749 (GRCm39)	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144,753,219 (GRCm39)	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144,726,409 (GRCm39)	splice site	probably benign
R1374:Trrap	UTSW	5	144,783,428 (GRCm39)	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144,794,232 (GRCm39)	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144,755,123 (GRCm39)	missense	probably benign
R1538:Trrap	UTSW	5	144,774,012 (GRCm39)	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144,751,385 (GRCm39)	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144,765,400 (GRCm39)	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144,759,513 (GRCm39)	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144,790,396 (GRCm39)	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144,767,761 (GRCm39)	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144,752,727 (GRCm39)	splice site	probably null
R1902:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144,790,298 (GRCm39)	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144,739,854 (GRCm39)	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144,765,372 (GRCm39)	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144,719,049 (GRCm39)	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144,762,684 (GRCm39)	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144,758,665 (GRCm39)	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144,754,776 (GRCm39)	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144,780,179 (GRCm39)	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144,729,062 (GRCm39)	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144,728,975 (GRCm39)	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144,767,858 (GRCm39)	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144,762,131 (GRCm39)	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144,728,928 (GRCm39)	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144,722,290 (GRCm39)	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144,740,087 (GRCm39)	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144,769,298 (GRCm39)	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144,737,758 (GRCm39)	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144,782,402 (GRCm39)	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144,742,545 (GRCm39)	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144,742,530 (GRCm39)	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144,793,770 (GRCm39)	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144,787,989 (GRCm39)	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144,754,596 (GRCm39)	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144,750,313 (GRCm39)	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144,781,034 (GRCm39)	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144,786,787 (GRCm39)	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144,719,075 (GRCm39)	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144,767,755 (GRCm39)	missense	probably benign
R5885:Trrap	UTSW	5	144,731,603 (GRCm39)	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144,786,730 (GRCm39)	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144,723,518 (GRCm39)	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144,744,201 (GRCm39)	splice site	silent
R5992:Trrap	UTSW	5	144,746,994 (GRCm39)	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144,781,051 (GRCm39)	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144,762,724 (GRCm39)	missense	possibly damaging	0.75
R6029:Trrap	UTSW	5	144,754,489 (GRCm39)	missense	possibly damaging	0.94
R6117:Trrap	UTSW	5	144,739,771 (GRCm39)	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144,718,791 (GRCm39)	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144,776,523 (GRCm39)	splice site	probably null
R6288:Trrap	UTSW	5	144,748,802 (GRCm39)	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144,741,828 (GRCm39)	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144,750,336 (GRCm39)	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144,727,680 (GRCm39)	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144,720,856 (GRCm39)	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144,793,812 (GRCm39)	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144,752,360 (GRCm39)	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144,708,460 (GRCm39)	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144,793,760 (GRCm39)	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144,788,066 (GRCm39)	nonsense	probably null
R6914:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144,728,964 (GRCm39)	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144,739,988 (GRCm39)	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144,758,613 (GRCm39)	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144,779,517 (GRCm39)	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144,795,764 (GRCm39)	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144,751,333 (GRCm39)	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144,726,208 (GRCm39)	missense	probably benign
R7447:Trrap	UTSW	5	144,776,284 (GRCm39)	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144,788,019 (GRCm39)	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144,769,321 (GRCm39)	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144,713,956 (GRCm39)	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144,772,707 (GRCm39)	splice site	probably null
R8265:Trrap	UTSW	5	144,722,344 (GRCm39)	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144,727,975 (GRCm39)	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144,762,747 (GRCm39)	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144,727,842 (GRCm39)	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144,782,348 (GRCm39)	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144,758,649 (GRCm39)	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144,757,063 (GRCm39)	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144,740,162 (GRCm39)	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144,783,226 (GRCm39)	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144,733,961 (GRCm39)	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144,767,830 (GRCm39)	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144,726,362 (GRCm39)	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144,708,049 (GRCm39)	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144,727,925 (GRCm39)	missense	probably benign
R9380:Trrap	UTSW	5	144,769,981 (GRCm39)	missense	probably benign
R9404:Trrap	UTSW	5	144,752,225 (GRCm39)	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144,763,478 (GRCm39)	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144,763,517 (GRCm39)	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144,742,904 (GRCm39)	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144,726,193 (GRCm39)	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144,758,716 (GRCm39)	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144,780,171 (GRCm39)	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144,771,007 (GRCm39)	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144,756,518 (GRCm39)	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144,747,154 (GRCm39)	missense
Z1177:Trrap	UTSW	5	144,793,761 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTTCAGGCCTGCAGCTAAC -3'
(R):5'- TAGCTTTGGGGTGGAAACAAGTC -3'

Sequencing Primer
(F):5'- ACTGTGACCCGAGATGTGGAC -3'
(R):5'- GTCCAACTCAAAACCAATGGC -3'

Posted On

2020-07-13