Incidental Mutation 'R8183:Dpy19l3'
ID634727
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8183 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35695389 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 575 (F575L)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
Predicted Effect probably damaging
Transcript: ENSMUST00000051377
AA Change: F575L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: F575L

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T A 15: 73,119,488 K534* probably null Het
Art1 A T 7: 102,107,426 I275F probably damaging Het
Atp1a2 T C 1: 172,289,351 N233S probably damaging Het
B3gnt2 T A 11: 22,836,373 I272L probably benign Het
Bpifa1 A G 2: 154,146,119 Q194R possibly damaging Het
Cand2 A G 6: 115,791,918 E563G probably benign Het
Clns1a A G 7: 97,705,681 Y78C probably damaging Het
Col20a1 T C 2: 180,998,414 V483A Het
Col3a1 C G 1: 45,334,810 P621R unknown Het
Cst9 G A 2: 148,836,714 R88H possibly damaging Het
Cxxc1 T C 18: 74,220,357 Y513H probably damaging Het
Dcdc2a T C 13: 25,107,650 F206S possibly damaging Het
Dgkz C A 2: 91,939,592 G576C probably damaging Het
Ftcd T A 10: 76,575,707 M1K probably null Het
Gtf2ird1 T C 5: 134,357,835 D1044G unknown Het
Gzmc A T 14: 56,232,707 M111K probably damaging Het
Hpse T A 5: 100,685,118 Y437F probably damaging Het
Ifi203 A G 1: 173,928,700 S506P unknown Het
Igsf10 A T 3: 59,330,615 I715K probably benign Het
Inadl A C 4: 98,674,229 E1534D probably damaging Het
Ints9 T C 14: 65,036,453 V569A probably damaging Het
Itih3 A G 14: 30,909,476 F821S probably benign Het
Kcnh7 T C 2: 62,702,977 H1186R probably damaging Het
Krt33a A G 11: 100,014,749 probably null Het
Lonrf1 A T 8: 36,222,665 M718K possibly damaging Het
Mefv C T 16: 3,708,582 R756K possibly damaging Het
Metap1d T A 2: 71,506,863 F40Y possibly damaging Het
Myh1 A T 11: 67,202,006 D42V possibly damaging Het
Nsd1 T C 13: 55,312,373 S2241P probably damaging Het
Olfr1495 T A 19: 13,768,722 Y127N probably damaging Het
Osbpl3 C A 6: 50,303,109 R710L probably benign Het
Osbpl6 C T 2: 76,585,060 R589C probably damaging Het
Pam T C 1: 97,834,474 T795A probably benign Het
Plscr5 A G 9: 92,198,602 Q47R probably benign Het
Sec23b G T 2: 144,559,269 V17L probably benign Het
Serpina3j C A 12: 104,318,495 Y310* probably null Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo3 A T 6: 29,558,759 M724K probably damaging Het
Trappc11 T G 8: 47,529,356 E116A possibly damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trrap T G 5: 144,828,533 S2501A probably benign Het
Ubr4 T G 4: 139,482,471 S5005A unknown Het
Urah A T 7: 140,836,794 Q60L probably benign Het
Vmn2r28 A T 7: 5,488,148 C367S probably damaging Het
Zmym1 T C 4: 127,058,856 D44G probably benign Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8206:Dpy19l3 UTSW 7 35729730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGGATTCGACAGCCCC -3'
(R):5'- CGCATAAAACTCCTTGGATGTAAG -3'

Sequencing Primer
(F):5'- GACAGCCCCATGCCCTTATG -3'
(R):5'- GGATGTAAGTCAGTTCTGCTCATCC -3'
Posted On2020-07-13