Incidental Mutation 'V1662:Itgav'
ID 63473
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Name integrin alpha V
Synonyms 1110004F14Rik, D430040G12Rik, CD51, vitronectin receptor alpha polypeptide (VNRA), 2610028E01Rik, alphav-integrin
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # V1662 () of strain 633
Quality Score 106
Status Not validated
Chromosome 2
Chromosomal Location 83554796-83637261 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83614198 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 519 (R519W)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
AlphaFold P43406
Predicted Effect possibly damaging
Transcript: ENSMUST00000028499
AA Change: R519W

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: R519W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111740
AA Change: R483W

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: R483W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,376,769 (GRCm39) G1951R probably damaging Het
Adamts12 T A 15: 11,071,894 (GRCm39) L146Q probably benign Het
Adgra1 T C 7: 139,432,495 (GRCm39) I111T probably damaging Het
Amph G A 13: 19,323,540 (GRCm39) V601M probably benign Het
Arfgef1 T C 1: 10,243,478 (GRCm39) K1024E probably damaging Het
Arhgef2 G A 3: 88,540,636 (GRCm39) R154Q probably damaging Het
Bank1 T A 3: 135,760,179 (GRCm39) D782V probably damaging Het
Bhlha9 G T 11: 76,563,862 (GRCm39) R163L probably benign Het
Cacna1h T C 17: 25,596,283 (GRCm39) N1913D possibly damaging Het
Cd7 T C 11: 120,927,952 (GRCm39) I184V probably benign Het
Cdk2ap1 T A 5: 124,486,739 (GRCm39) I68F possibly damaging Het
Cfap44 C A 16: 44,269,501 (GRCm39) Y1168* probably null Het
D6Ertd527e T C 6: 87,088,874 (GRCm39) S346P unknown Het
Daam2 A G 17: 49,771,629 (GRCm39) L839P possibly damaging Het
Gask1a A G 9: 121,794,091 (GRCm39) R82G probably damaging Het
Golgb1 A G 16: 36,718,904 (GRCm39) H270R probably benign Het
H2-T9 A G 17: 36,439,823 (GRCm39) Y104H probably benign Het
Lrp1b A T 2: 41,012,944 (GRCm39) I2001K probably damaging Het
Lrrc40 T A 3: 157,758,426 (GRCm39) I277K probably damaging Het
Or2y8 T C 11: 52,036,004 (GRCm39) M118V probably damaging Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or5m13 C A 2: 85,748,938 (GRCm39) T223K probably benign Het
Or6b13 C T 7: 139,781,871 (GRCm39) D271N possibly damaging Het
Pyroxd1 G A 6: 142,304,169 (GRCm39) G307S probably damaging Het
Rp1 T A 1: 4,419,783 (GRCm39) Y443F probably damaging Het
Rpusd4 C A 9: 35,184,057 (GRCm39) S237R probably benign Het
Sdk2 A C 11: 113,725,734 (GRCm39) W1172G probably damaging Het
Utrn A G 10: 12,297,384 (GRCm39) Y675H probably damaging Het
Vmn1r193 A G 13: 22,403,245 (GRCm39) I249T possibly damaging Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83,633,339 (GRCm39) missense probably damaging 1.00
IGL01969:Itgav APN 2 83,633,627 (GRCm39) missense probably damaging 1.00
IGL02371:Itgav APN 2 83,600,397 (GRCm39) missense probably damaging 1.00
IGL02563:Itgav APN 2 83,601,580 (GRCm39) missense probably benign
IGL02640:Itgav APN 2 83,622,283 (GRCm39) missense probably benign 0.33
IGL02641:Itgav APN 2 83,598,689 (GRCm39) splice site probably benign
IGL02927:Itgav APN 2 83,625,884 (GRCm39) missense probably damaging 1.00
IGL03172:Itgav APN 2 83,596,190 (GRCm39) missense possibly damaging 0.51
R0158:Itgav UTSW 2 83,622,381 (GRCm39) missense probably benign 0.33
R0346:Itgav UTSW 2 83,622,953 (GRCm39) missense probably damaging 1.00
R0508:Itgav UTSW 2 83,623,002 (GRCm39) splice site probably benign
R0546:Itgav UTSW 2 83,633,586 (GRCm39) missense probably benign 0.04
R0554:Itgav UTSW 2 83,624,614 (GRCm39) missense possibly damaging 0.95
R1122:Itgav UTSW 2 83,622,283 (GRCm39) missense probably benign 0.33
R1468:Itgav UTSW 2 83,596,245 (GRCm39) splice site probably benign
R1566:Itgav UTSW 2 83,566,974 (GRCm39) missense probably damaging 1.00
R1657:Itgav UTSW 2 83,632,123 (GRCm39) missense probably benign 0.21
R1892:Itgav UTSW 2 83,601,680 (GRCm39) missense probably damaging 1.00
R1912:Itgav UTSW 2 83,625,830 (GRCm39) missense possibly damaging 0.85
R2176:Itgav UTSW 2 83,633,599 (GRCm39) missense probably damaging 1.00
R2438:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R2449:Itgav UTSW 2 83,599,094 (GRCm39) critical splice donor site probably null
R3110:Itgav UTSW 2 83,622,915 (GRCm39) nonsense probably null
R3112:Itgav UTSW 2 83,622,915 (GRCm39) nonsense probably null
R3176:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3177:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3276:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3277:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3766:Itgav UTSW 2 83,632,229 (GRCm39) critical splice donor site probably null
R3774:Itgav UTSW 2 83,622,308 (GRCm39) missense probably damaging 1.00
R3880:Itgav UTSW 2 83,598,645 (GRCm39) missense probably damaging 1.00
R4196:Itgav UTSW 2 83,598,671 (GRCm39) missense probably benign 0.24
R4287:Itgav UTSW 2 83,555,184 (GRCm39) nonsense probably null
R4620:Itgav UTSW 2 83,586,246 (GRCm39) missense probably benign 0.07
R4790:Itgav UTSW 2 83,586,154 (GRCm39) missense probably damaging 1.00
R4946:Itgav UTSW 2 83,619,327 (GRCm39) missense probably benign 0.16
R6150:Itgav UTSW 2 83,606,780 (GRCm39) missense probably benign
R6345:Itgav UTSW 2 83,632,380 (GRCm39) missense probably damaging 1.00
R6482:Itgav UTSW 2 83,624,614 (GRCm39) missense probably damaging 1.00
R6900:Itgav UTSW 2 83,633,591 (GRCm39) missense probably damaging 1.00
R7247:Itgav UTSW 2 83,555,179 (GRCm39) missense probably damaging 0.98
R7317:Itgav UTSW 2 83,625,327 (GRCm39) missense probably benign 0.12
R7429:Itgav UTSW 2 83,624,602 (GRCm39) missense probably damaging 1.00
R7430:Itgav UTSW 2 83,624,602 (GRCm39) missense probably damaging 1.00
R7522:Itgav UTSW 2 83,632,373 (GRCm39) missense probably benign 0.10
R7546:Itgav UTSW 2 83,606,894 (GRCm39) nonsense probably null
R7578:Itgav UTSW 2 83,578,219 (GRCm39) missense probably benign 0.16
R8311:Itgav UTSW 2 83,596,121 (GRCm39) missense probably damaging 1.00
R8497:Itgav UTSW 2 83,615,805 (GRCm39) missense probably damaging 1.00
R8744:Itgav UTSW 2 83,600,427 (GRCm39) missense probably benign 0.25
R9752:Itgav UTSW 2 83,600,451 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCCGATAGGAAGGGGCATATAC -3'
(R):5'- GCCTTGCTCTCAGACCACATCAATC -3'

Sequencing Primer
(F):5'- CCGATAGGAAGGGGCATATACATTAG -3'
(R):5'- GCTCTCAGTAGAGCACAGATTC -3'
Posted On 2013-07-30