Mutagenetix > Incidental Mutation

Incidental Mutation 'V1662:Itgav'

63473

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

V1662 () of strain 633

Quality Score

106

Status

Not validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83783854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 519 (R519W)

Ref Sequence

ENSEMBL: ENSMUSP00000028499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028499
AA Change: R519W

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: R519W

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111740
AA Change: R483W

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: R483W

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Amph	G	A	13: 19,139,370	V601M	probably benign	Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cacna1h	T	C	17: 25,377,309	N1913D	possibly damaging	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
Cfap44	C	A	16: 44,449,138	Y1168*	probably null	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Pyroxd1	G	A	6: 142,358,443	G307S	probably damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCCGATAGGAAGGGGCATATAC -3'
(R):5'- GCCTTGCTCTCAGACCACATCAATC -3'

Sequencing Primer
(F):5'- CCGATAGGAAGGGGCATATACATTAG -3'
(R):5'- GCTCTCAGTAGAGCACAGATTC -3'

Posted On

2013-07-30