Incidental Mutation 'R8183:Lonrf1'
ID634732
Institutional Source Beutler Lab
Gene Symbol Lonrf1
Ensembl Gene ENSMUSG00000039633
Gene NameLON peptidase N-terminal domain and ring finger 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R8183 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location36216064-36249516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36222665 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 718 (M718K)
Ref Sequence ENSEMBL: ENSMUSP00000066403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065297
AA Change: M718K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633
AA Change: M718K

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T A 15: 73,119,488 K534* probably null Het
Art1 A T 7: 102,107,426 I275F probably damaging Het
Atp1a2 T C 1: 172,289,351 N233S probably damaging Het
B3gnt2 T A 11: 22,836,373 I272L probably benign Het
Bpifa1 A G 2: 154,146,119 Q194R possibly damaging Het
Cand2 A G 6: 115,791,918 E563G probably benign Het
Clns1a A G 7: 97,705,681 Y78C probably damaging Het
Col20a1 T C 2: 180,998,414 V483A Het
Col3a1 C G 1: 45,334,810 P621R unknown Het
Cst9 G A 2: 148,836,714 R88H possibly damaging Het
Cxxc1 T C 18: 74,220,357 Y513H probably damaging Het
Dcdc2a T C 13: 25,107,650 F206S possibly damaging Het
Dgkz C A 2: 91,939,592 G576C probably damaging Het
Dpy19l3 A G 7: 35,695,389 F575L probably damaging Het
Ftcd T A 10: 76,575,707 M1K probably null Het
Gtf2ird1 T C 5: 134,357,835 D1044G unknown Het
Gzmc A T 14: 56,232,707 M111K probably damaging Het
Hpse T A 5: 100,685,118 Y437F probably damaging Het
Ifi203 A G 1: 173,928,700 S506P unknown Het
Igsf10 A T 3: 59,330,615 I715K probably benign Het
Inadl A C 4: 98,674,229 E1534D probably damaging Het
Ints9 T C 14: 65,036,453 V569A probably damaging Het
Itih3 A G 14: 30,909,476 F821S probably benign Het
Kcnh7 T C 2: 62,702,977 H1186R probably damaging Het
Krt33a A G 11: 100,014,749 probably null Het
Mefv C T 16: 3,708,582 R756K possibly damaging Het
Metap1d T A 2: 71,506,863 F40Y possibly damaging Het
Myh1 A T 11: 67,202,006 D42V possibly damaging Het
Nsd1 T C 13: 55,312,373 S2241P probably damaging Het
Olfr1495 T A 19: 13,768,722 Y127N probably damaging Het
Osbpl3 C A 6: 50,303,109 R710L probably benign Het
Osbpl6 C T 2: 76,585,060 R589C probably damaging Het
Pam T C 1: 97,834,474 T795A probably benign Het
Plscr5 A G 9: 92,198,602 Q47R probably benign Het
Sec23b G T 2: 144,559,269 V17L probably benign Het
Serpina3j C A 12: 104,318,495 Y310* probably null Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo3 A T 6: 29,558,759 M724K probably damaging Het
Trappc11 T G 8: 47,529,356 E116A possibly damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trrap T G 5: 144,828,533 S2501A probably benign Het
Ubr4 T G 4: 139,482,471 S5005A unknown Het
Urah A T 7: 140,836,794 Q60L probably benign Het
Vmn2r28 A T 7: 5,488,148 C367S probably damaging Het
Zmym1 T C 4: 127,058,856 D44G probably benign Het
Other mutations in Lonrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lonrf1 APN 8 36230077 splice site probably benign
IGL02195:Lonrf1 APN 8 36219948 nonsense probably null
IGL03087:Lonrf1 APN 8 36225551 splice site probably null
IGL03163:Lonrf1 APN 8 36230330 missense probably benign 0.03
IGL03225:Lonrf1 APN 8 36222701 missense probably damaging 0.96
BB009:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
BB019:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R0480:Lonrf1 UTSW 8 36222710 missense probably damaging 1.00
R0504:Lonrf1 UTSW 8 36231159 missense possibly damaging 0.93
R0557:Lonrf1 UTSW 8 36230420 missense probably benign 0.12
R1489:Lonrf1 UTSW 8 36222954 missense probably damaging 1.00
R1572:Lonrf1 UTSW 8 36233972 missense probably benign 0.02
R2225:Lonrf1 UTSW 8 36236098 missense probably damaging 0.98
R2345:Lonrf1 UTSW 8 36222862 critical splice donor site probably null
R4821:Lonrf1 UTSW 8 36219972 missense probably benign
R4934:Lonrf1 UTSW 8 36233949 missense probably damaging 1.00
R5538:Lonrf1 UTSW 8 36223024 critical splice acceptor site probably null
R6124:Lonrf1 UTSW 8 36229200 missense probably damaging 0.97
R6485:Lonrf1 UTSW 8 36229134 critical splice donor site probably null
R6603:Lonrf1 UTSW 8 36222941 missense probably damaging 1.00
R6886:Lonrf1 UTSW 8 36229037 splice site probably null
R7113:Lonrf1 UTSW 8 36230510 missense probably benign 0.01
R7689:Lonrf1 UTSW 8 36248764 nonsense probably null
R7711:Lonrf1 UTSW 8 36249221 missense probably damaging 1.00
R7743:Lonrf1 UTSW 8 36249052 missense possibly damaging 0.72
R7932:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R8085:Lonrf1 UTSW 8 36248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTCCTGAATGGGCAAAC -3'
(R):5'- TTGCACCGGAGCTTCCTTTG -3'

Sequencing Primer
(F):5'- GAGCTCCTGAATGGGCAAACAATTC -3'
(R):5'- GTGTCCGAATGGGCTGAAGC -3'
Posted On2020-07-13