Incidental Mutation 'R8183:Trappc11'
ID634733
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8183 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 47529356 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 116 (E116A)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033973] [ENSMUST00000039061] [ENSMUST00000175692] [ENSMUST00000176379]
Predicted Effect probably benign
Transcript: ENSMUST00000033973
SMART Domains Protein: ENSMUSP00000033973
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
low complexity region 131 153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039061
AA Change: E116A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: E116A

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175692
Predicted Effect probably benign
Transcript: ENSMUST00000176379
SMART Domains Protein: ENSMUSP00000135059
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T A 15: 73,119,488 K534* probably null Het
Art1 A T 7: 102,107,426 I275F probably damaging Het
Atp1a2 T C 1: 172,289,351 N233S probably damaging Het
B3gnt2 T A 11: 22,836,373 I272L probably benign Het
Bpifa1 A G 2: 154,146,119 Q194R possibly damaging Het
Cand2 A G 6: 115,791,918 E563G probably benign Het
Clns1a A G 7: 97,705,681 Y78C probably damaging Het
Col20a1 T C 2: 180,998,414 V483A Het
Col3a1 C G 1: 45,334,810 P621R unknown Het
Cst9 G A 2: 148,836,714 R88H possibly damaging Het
Cxxc1 T C 18: 74,220,357 Y513H probably damaging Het
Dcdc2a T C 13: 25,107,650 F206S possibly damaging Het
Dgkz C A 2: 91,939,592 G576C probably damaging Het
Dpy19l3 A G 7: 35,695,389 F575L probably damaging Het
Ftcd T A 10: 76,575,707 M1K probably null Het
Gtf2ird1 T C 5: 134,357,835 D1044G unknown Het
Gzmc A T 14: 56,232,707 M111K probably damaging Het
Hpse T A 5: 100,685,118 Y437F probably damaging Het
Ifi203 A G 1: 173,928,700 S506P unknown Het
Igsf10 A T 3: 59,330,615 I715K probably benign Het
Inadl A C 4: 98,674,229 E1534D probably damaging Het
Ints9 T C 14: 65,036,453 V569A probably damaging Het
Itih3 A G 14: 30,909,476 F821S probably benign Het
Kcnh7 T C 2: 62,702,977 H1186R probably damaging Het
Krt33a A G 11: 100,014,749 probably null Het
Lonrf1 A T 8: 36,222,665 M718K possibly damaging Het
Mefv C T 16: 3,708,582 R756K possibly damaging Het
Metap1d T A 2: 71,506,863 F40Y possibly damaging Het
Myh1 A T 11: 67,202,006 D42V possibly damaging Het
Myo15b T G 11: 115,883,017 probably null Het
Nsd1 T C 13: 55,312,373 S2241P probably damaging Het
Olfr1495 T A 19: 13,768,722 Y127N probably damaging Het
Osbpl3 C A 6: 50,303,109 R710L probably benign Het
Osbpl6 C T 2: 76,585,060 R589C probably damaging Het
Pam T C 1: 97,834,474 T795A probably benign Het
Plscr5 A G 9: 92,198,602 Q47R probably benign Het
Ppil1 A T 17: 29,262,079 probably null Het
Sec23b G T 2: 144,559,269 V17L probably benign Het
Serpina3j C A 12: 104,318,495 Y310* probably null Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo3 A T 6: 29,558,759 M724K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trrap T G 5: 144,828,533 S2501A probably benign Het
Ubr4 T G 4: 139,482,471 S5005A unknown Het
Urah A T 7: 140,836,794 Q60L probably benign Het
Vmn2r28 A T 7: 5,488,148 C367S probably damaging Het
Zmym1 T C 4: 127,058,856 D44G probably benign Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R7964:Trappc11 UTSW 8 47526944 missense possibly damaging 0.54
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8733:Trappc11 UTSW 8 47501848 missense probably damaging 1.00
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGAATTTCAAAGGAGGTCAAC -3'
(R):5'- CAGCTAACTGTTTCTGTCACGG -3'

Sequencing Primer
(F):5'- ATCCCAGTTTAAACACTGTTCGG -3'
(R):5'- TCACGGTTGGCAGAGAACGTC -3'
Posted On2020-07-13