Incidental Mutation 'V1662:Olfr1025-ps1'
ID63474
Institutional Source Beutler Lab
Gene Symbol Olfr1025-ps1
Ensembl Gene ENSMUSG00000058884
Gene Nameolfactory receptor 1025, pseudogene 1
SynonymsMOR196-6_p, GA_x6K02T2Q125-47397266-47398205, MOR196-5P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #V1662 () of strain 633
Quality Score172
Status Not validated
Chromosome2
Chromosomal Location85915193-85921381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85918594 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 223 (T223K)
Ref Sequence ENSEMBL: ENSMUSP00000149785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056718] [ENSMUST00000188749] [ENSMUST00000213474] [ENSMUST00000217615] [ENSMUST00000219615]
Predicted Effect probably benign
Transcript: ENSMUST00000056718
SMART Domains Protein: ENSMUSP00000049887
Gene: ENSMUSG00000042863

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-58 PFAM
Pfam:7tm_1 41 290 9e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000076311
Gene: ENSMUSG00000058884
AA Change: T223K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-57 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188749
AA Change: T223K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139860
Gene: ENSMUSG00000058884
AA Change: T223K

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 7.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213474
AA Change: T223K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217615
Predicted Effect probably benign
Transcript: ENSMUST00000219615
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Olfr1025-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Olfr1025-ps1 APN 2 85918564 missense probably benign 0.25
IGL02881:Olfr1025-ps1 APN 2 85918116 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0324:Olfr1025-ps1 UTSW 2 85917951 missense probably benign 0.22
R0392:Olfr1025-ps1 UTSW 2 85918762 missense possibly damaging 0.81
R0765:Olfr1025-ps1 UTSW 2 85918705 missense probably damaging 0.99
R1199:Olfr1025-ps1 UTSW 2 85918035 missense probably benign 0.00
R1894:Olfr1025-ps1 UTSW 2 85918255 missense probably benign 0.28
R2027:Olfr1025-ps1 UTSW 2 85918770 missense probably damaging 0.99
R2141:Olfr1025-ps1 UTSW 2 85918827 missense probably null
R3871:Olfr1025-ps1 UTSW 2 85918582 splice site probably null
R4837:Olfr1025-ps1 UTSW 2 85918404 missense probably benign 0.00
R4945:Olfr1025-ps1 UTSW 2 85918573 missense possibly damaging 0.81
R5056:Olfr1025-ps1 UTSW 2 85918136 missense probably damaging 1.00
R5441:Olfr1025-ps1 UTSW 2 85918590 missense probably benign 0.01
R5960:Olfr1025-ps1 UTSW 2 85918725 missense probably benign 0.07
R6807:Olfr1025-ps1 UTSW 2 85918038 missense possibly damaging 0.48
R7320:Olfr1025-ps1 UTSW 2 85918374 missense probably benign 0.00
R8523:Olfr1025-ps1 UTSW 2 85918063 missense probably damaging 0.97
Z1176:Olfr1025-ps1 UTSW 2 85918501 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAAATGTCCAGAAGCGTCTGCC -3'
(R):5'- AGACCGCCACAATTTTCCCCTG -3'

Sequencing Primer
(F):5'- TTGCAAATGGCCTGGCAC -3'
(R):5'- GCTCTACAGACTTCTCAGATGG -3'
Posted On2013-07-30