Incidental Mutation 'R8183:Ints9'
ID 634745
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8183 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 64950045-65039832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65036453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 569 (V569A)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably damaging
Transcript: ENSMUST00000043914
AA Change: V569A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: V569A

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Meta Mutation Damage Score 0.6396 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T A 15: 73,119,488 K534* probably null Het
Art1 A T 7: 102,107,426 I275F probably damaging Het
Atp1a2 T C 1: 172,289,351 N233S probably damaging Het
B3gnt2 T A 11: 22,836,373 I272L probably benign Het
Bpifa1 A G 2: 154,146,119 Q194R possibly damaging Het
Cand2 A G 6: 115,791,918 E563G probably benign Het
Clns1a A G 7: 97,705,681 Y78C probably damaging Het
Col20a1 T C 2: 180,998,414 V483A Het
Col3a1 C G 1: 45,334,810 P621R unknown Het
Cst9 G A 2: 148,836,714 R88H possibly damaging Het
Cxxc1 T C 18: 74,220,357 Y513H probably damaging Het
Dcdc2a T C 13: 25,107,650 F206S possibly damaging Het
Dgkz C A 2: 91,939,592 G576C probably damaging Het
Dpy19l3 A G 7: 35,695,389 F575L probably damaging Het
Ftcd T A 10: 76,575,707 M1K probably null Het
Gtf2ird1 T C 5: 134,357,835 D1044G unknown Het
Gzmc A T 14: 56,232,707 M111K probably damaging Het
Hpse T A 5: 100,685,118 Y437F probably damaging Het
Ifi203 A G 1: 173,928,700 S506P unknown Het
Igsf10 A T 3: 59,330,615 I715K probably benign Het
Inadl A C 4: 98,674,229 E1534D probably damaging Het
Itih3 A G 14: 30,909,476 F821S probably benign Het
Kcnh7 T C 2: 62,702,977 H1186R probably damaging Het
Krt33a A G 11: 100,014,749 probably null Het
Lonrf1 A T 8: 36,222,665 M718K possibly damaging Het
Mefv C T 16: 3,708,582 R756K possibly damaging Het
Metap1d T A 2: 71,506,863 F40Y possibly damaging Het
Myh1 A T 11: 67,202,006 D42V possibly damaging Het
Myo15b T G 11: 115,883,017 probably null Het
Nsd1 T C 13: 55,312,373 S2241P probably damaging Het
Olfr1495 T A 19: 13,768,722 Y127N probably damaging Het
Osbpl3 C A 6: 50,303,109 R710L probably benign Het
Osbpl6 C T 2: 76,585,060 R589C probably damaging Het
Pam T C 1: 97,834,474 T795A probably benign Het
Plscr5 A G 9: 92,198,602 Q47R probably benign Het
Ppil1 A T 17: 29,262,079 probably null Het
Sec23b G T 2: 144,559,269 V17L probably benign Het
Serpina3j C A 12: 104,318,495 Y310* probably null Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo3 A T 6: 29,558,759 M724K probably damaging Het
Trappc11 T G 8: 47,529,356 E116A possibly damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trrap T G 5: 144,828,533 S2501A probably benign Het
Ubr4 T G 4: 139,482,471 S5005A unknown Het
Urah A T 7: 140,836,794 Q60L probably benign Het
Vmn2r28 A T 7: 5,488,148 C367S probably damaging Het
Zmym1 T C 4: 127,058,856 D44G probably benign Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
R8223:Ints9 UTSW 14 65020360 missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65007308 missense probably benign 0.00
R8314:Ints9 UTSW 14 65029030 missense probably damaging 1.00
R8341:Ints9 UTSW 14 65036414 missense probably benign 0.14
R8548:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9356:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9434:Ints9 UTSW 14 65008057 missense probably benign 0.00
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACAGTATGATGGCCGTCC -3'
(R):5'- TCTATGTTTCGAGTACACCCAAGTC -3'

Sequencing Primer
(F):5'- CAGTATGATGGCCGTCCTTGGAG -3'
(R):5'- TTCGAGTACACCCAAGTCTCCATC -3'
Posted On 2020-07-13