Incidental Mutation 'R8184:Gbx2'
ID634756
Institutional Source Beutler Lab
Gene Symbol Gbx2
Ensembl Gene ENSMUSG00000034486
Gene Namegastrulation brain homeobox 2
SynonymsGbx-2, Stra7, MMoxA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8184 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location89927956-89931179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89928828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 280 (I280N)
Ref Sequence ENSEMBL: ENSMUSP00000048508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036954]
Predicted Effect probably damaging
Transcript: ENSMUST00000036954
AA Change: I280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048508
Gene: ENSMUSG00000034486
AA Change: I280N

DomainStartEndE-ValueType
low complexity region 56 82 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
HOX 247 309 7.58e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with vascular, neurological, skeletal, and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T C 2: 93,855,741 K577R probably benign Het
Amica1 T A 9: 45,088,812 L136Q probably damaging Het
Baiap3 A G 17: 25,248,525 S368P probably benign Het
Brf2 T C 8: 27,123,985 E391G possibly damaging Het
Casr T A 16: 36,509,746 M409L probably benign Het
Ccdc83 G T 7: 90,224,078 Y356* probably null Het
Clec10a A T 11: 70,169,816 N166Y probably damaging Het
Copg1 T C 6: 87,890,014 F77S probably damaging Het
Dnah7a T G 1: 53,627,035 K611T probably benign Het
Dock10 G A 1: 80,552,752 H1025Y probably damaging Het
Dock6 A T 9: 21,830,300 S876T possibly damaging Het
Dopey2 G T 16: 93,776,993 R1701L probably benign Het
Dus4l A G 12: 31,640,818 F278S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fbxo43 C T 15: 36,162,339 V241I possibly damaging Het
Gm9573 A G 17: 35,622,830 S155P unknown Het
Gnai1 A G 5: 18,291,506 F140L Het
Gne T C 4: 44,084,061 Y13C probably benign Het
Heatr5b A T 17: 78,814,233 S688T probably benign Het
Hectd2 T A 19: 36,604,354 D431E possibly damaging Het
Hecw2 A G 1: 54,040,387 S36P probably benign Het
Hpx A T 7: 105,592,145 I353N probably damaging Het
Ints8 A T 4: 11,204,534 V974E probably damaging Het
Kazn A G 4: 142,118,130 V381A probably benign Het
Krt79 T C 15: 101,929,752 T523A unknown Het
Lrrc8e T G 8: 4,235,140 L455R probably damaging Het
Mrps11 T C 7: 78,783,377 S7P possibly damaging Het
Neurl3 A G 1: 36,269,581 F50S probably damaging Het
Nlgn1 T C 3: 25,436,199 T455A probably damaging Het
Pbp2 T C 6: 135,310,262 Y29C probably damaging Het
Pdcd11 T A 19: 47,113,352 L992* probably null Het
Pla2g6 A G 15: 79,287,122 I756T probably benign Het
Polm T A 11: 5,831,707 D263V possibly damaging Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rtca C A 3: 116,507,824 A25S probably benign Het
Sirt2 G A 7: 28,787,766 V318M probably damaging Het
Slc1a2 T A 2: 102,737,852 I78K probably damaging Het
Slco3a1 A G 7: 74,359,829 I246T probably benign Het
Smpd5 A G 15: 76,295,726 E325G probably benign Het
Snw1 T C 12: 87,453,903 E362G probably benign Het
Tmem63c A T 12: 87,061,554 M114L possibly damaging Het
Trim24 T C 6: 37,871,307 L66P probably damaging Het
Trpm3 T C 19: 22,918,696 F966L possibly damaging Het
Ttn T C 2: 76,779,299 I17588V probably benign Het
Vmn2r44 A T 7: 8,368,228 C606* probably null Het
Vmn2r74 A T 7: 85,952,246 V728E probably benign Het
Zfp503 T C 14: 21,985,951 D299G possibly damaging Het
Other mutations in Gbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Gbx2 APN 1 89928837 missense probably damaging 1.00
IGL01804:Gbx2 APN 1 89928981 missense probably benign 0.00
IGL02345:Gbx2 APN 1 89928976 missense probably benign 0.00
IGL02370:Gbx2 APN 1 89929149 splice site probably benign
IGL02957:Gbx2 APN 1 89930653 missense probably benign 0.02
IGL02959:Gbx2 APN 1 89928795 missense probably damaging 1.00
R2280:Gbx2 UTSW 1 89930637 missense probably damaging 1.00
R2405:Gbx2 UTSW 1 89930908 start gained probably benign
R2860:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R2861:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R5384:Gbx2 UTSW 1 89928913 missense probably damaging 1.00
R5587:Gbx2 UTSW 1 89933122 unclassified probably benign
R5747:Gbx2 UTSW 1 89928715 missense probably damaging 0.98
R5956:Gbx2 UTSW 1 89933186 unclassified probably benign
R6053:Gbx2 UTSW 1 89930437 missense probably benign 0.00
R6633:Gbx2 UTSW 1 89928720 frame shift probably null
R7479:Gbx2 UTSW 1 89930651 missense probably benign 0.02
R7505:Gbx2 UTSW 1 89928733 missense probably benign 0.26
R7768:Gbx2 UTSW 1 89928984 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGCTGCTGGTGTTGACTTC -3'
(R):5'- TGACAATTTGCCTGGTCAGAC -3'

Sequencing Primer
(F):5'- CGAATAGCGAACCTGCTAACGTG -3'
(R):5'- TGCCTGGTCAGACTGCTCATAAG -3'
Posted On2020-07-13