Incidental Mutation 'V1662:Lrrc40'
ID 63479
Institutional Source Beutler Lab
Gene Symbol Lrrc40
Ensembl Gene ENSMUSG00000063052
Gene Name leucine rich repeat containing 40
Synonyms 2610040E16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock # V1662 () of strain 633
Quality Score 137
Status Not validated
Chromosome 3
Chromosomal Location 158036662-158068487 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 158052789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 277 (I277K)
Ref Sequence ENSEMBL: ENSMUSP00000071956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072080] [ENSMUST00000150525] [ENSMUST00000156597] [ENSMUST00000200540]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000072080
AA Change: I277K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071956
Gene: ENSMUSG00000063052
AA Change: I277K

DomainStartEndE-ValueType
LRR 81 100 7.11e1 SMART
LRR 104 126 6.13e-1 SMART
LRR 127 149 1.51e0 SMART
LRR_TYP 150 172 8.47e-4 SMART
LRR 173 195 3.52e-1 SMART
LRR_TYP 196 219 2.91e-2 SMART
LRR 242 261 9.15e0 SMART
LRR 265 287 1.01e2 SMART
LRR 288 310 1.86e1 SMART
LRR 311 334 2.32e-1 SMART
LRR 335 356 2.21e2 SMART
LRR 471 493 1.86e0 SMART
LRR 494 517 8.97e0 SMART
LRR 541 564 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123028
SMART Domains Protein: ENSMUSP00000121905
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 37 68 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131518
SMART Domains Protein: ENSMUSP00000121417
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 80 110 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150525
SMART Domains Protein: ENSMUSP00000116475
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 81 111 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156597
Predicted Effect probably benign
Transcript: ENSMUST00000200540
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Lrrc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrc40 APN 3 158048450 missense probably damaging 1.00
IGL00501:Lrrc40 APN 3 158061282 missense probably damaging 0.96
IGL00727:Lrrc40 APN 3 158063871 critical splice donor site probably null
IGL01349:Lrrc40 APN 3 158058665 splice site probably benign
IGL02377:Lrrc40 APN 3 158036728 start codon destroyed probably null 1.00
IGL02490:Lrrc40 APN 3 158062699 missense probably damaging 1.00
IGL02657:Lrrc40 APN 3 158036773 missense probably damaging 1.00
IGL02879:Lrrc40 APN 3 158041665 intron probably benign
IGL02944:Lrrc40 APN 3 158041665 intron probably benign
IGL02954:Lrrc40 APN 3 158041665 intron probably benign
IGL02966:Lrrc40 APN 3 158041665 intron probably benign
IGL03004:Lrrc40 APN 3 158041665 intron probably benign
IGL03032:Lrrc40 APN 3 158041665 intron probably benign
IGL03112:Lrrc40 APN 3 158041665 intron probably benign
IGL03163:Lrrc40 APN 3 158041587 missense possibly damaging 0.82
I2288:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
R0266:Lrrc40 UTSW 3 158041661 critical splice donor site probably null
R0355:Lrrc40 UTSW 3 158040471 missense probably damaging 0.99
R0457:Lrrc40 UTSW 3 158054564 splice site probably null
R0968:Lrrc40 UTSW 3 158036789 missense probably damaging 1.00
R1799:Lrrc40 UTSW 3 158036804 missense probably benign 0.38
R1962:Lrrc40 UTSW 3 158040449 missense probably benign 0.01
R4614:Lrrc40 UTSW 3 158054634 missense probably damaging 1.00
R4825:Lrrc40 UTSW 3 158061330 nonsense probably null
R4857:Lrrc40 UTSW 3 158066229 utr 3 prime probably benign
R4947:Lrrc40 UTSW 3 158063835 missense probably benign 0.00
R5148:Lrrc40 UTSW 3 158054569 splice site probably null
R5673:Lrrc40 UTSW 3 158048398 splice site probably null
R6354:Lrrc40 UTSW 3 158061264 nonsense probably null
R6382:Lrrc40 UTSW 3 158058696 missense probably damaging 0.98
R6713:Lrrc40 UTSW 3 158063713 missense probably benign 0.00
R7081:Lrrc40 UTSW 3 158036805 missense probably damaging 0.98
R7098:Lrrc40 UTSW 3 158041639 missense probably benign 0.29
R7484:Lrrc40 UTSW 3 158040557 missense probably benign 0.14
R8043:Lrrc40 UTSW 3 158063760 missense possibly damaging 0.81
R8093:Lrrc40 UTSW 3 158051782 nonsense probably null
R8461:Lrrc40 UTSW 3 158058734 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGTTTGAGGTATAGCATTAGCACTGC -3'
(R):5'- TCTGAAATGTGACTACACATCTGCTTCC -3'

Sequencing Primer
(F):5'- GCTGGGAAATTCCATTCACTATG -3'
(R):5'- ATTAACTTGGCTGTCAGGGAAG -3'
Posted On 2013-07-30