Incidental Mutation 'R8184:Krt79'
ID634791
Institutional Source Beutler Lab
Gene Symbol Krt79
Ensembl Gene ENSMUSG00000061397
Gene Namekeratin 79
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8184 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101929332-101940324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101929752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 523 (T523A)
Ref Sequence ENSEMBL: ENSMUSP00000023799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023799]
Predicted Effect unknown
Transcript: ENSMUST00000023799
AA Change: T523A
SMART Domains Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: T523A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 98 6.6e-11 PFAM
Pfam:Keratin_2_head 73 135 1.2e-21 PFAM
Filament 138 452 7.12e-159 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T C 2: 93,855,741 K577R probably benign Het
Amica1 T A 9: 45,088,812 L136Q probably damaging Het
Baiap3 A G 17: 25,248,525 S368P probably benign Het
Brf2 T C 8: 27,123,985 E391G possibly damaging Het
Casr T A 16: 36,509,746 M409L probably benign Het
Ccdc83 G T 7: 90,224,078 Y356* probably null Het
Clec10a A T 11: 70,169,816 N166Y probably damaging Het
Copg1 T C 6: 87,890,014 F77S probably damaging Het
Dnah7a T G 1: 53,627,035 K611T probably benign Het
Dock10 G A 1: 80,552,752 H1025Y probably damaging Het
Dock6 A T 9: 21,830,300 S876T possibly damaging Het
Dopey2 G T 16: 93,776,993 R1701L probably benign Het
Dus4l A G 12: 31,640,818 F278S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fbxo43 C T 15: 36,162,339 V241I possibly damaging Het
Gbx2 A T 1: 89,928,828 I280N probably damaging Het
Gm9573 A G 17: 35,622,830 S155P unknown Het
Gnai1 A G 5: 18,291,506 F140L Het
Gne T C 4: 44,084,061 Y13C probably benign Het
Heatr5b A T 17: 78,814,233 S688T probably benign Het
Hectd2 T A 19: 36,604,354 D431E possibly damaging Het
Hecw2 A G 1: 54,040,387 S36P probably benign Het
Hpx A T 7: 105,592,145 I353N probably damaging Het
Ints8 A T 4: 11,204,534 V974E probably damaging Het
Kazn A G 4: 142,118,130 V381A probably benign Het
Lrrc8e T G 8: 4,235,140 L455R probably damaging Het
Mrps11 T C 7: 78,783,377 S7P possibly damaging Het
Neurl3 A G 1: 36,269,581 F50S probably damaging Het
Nlgn1 T C 3: 25,436,199 T455A probably damaging Het
Pbp2 T C 6: 135,310,262 Y29C probably damaging Het
Pdcd11 T A 19: 47,113,352 L992* probably null Het
Pla2g6 A G 15: 79,287,122 I756T probably benign Het
Polm T A 11: 5,831,707 D263V possibly damaging Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rtca C A 3: 116,507,824 A25S probably benign Het
Sirt2 G A 7: 28,787,766 V318M probably damaging Het
Slc1a2 T A 2: 102,737,852 I78K probably damaging Het
Slco3a1 A G 7: 74,359,829 I246T probably benign Het
Smpd5 A G 15: 76,295,726 E325G probably benign Het
Snw1 T C 12: 87,453,903 E362G probably benign Het
Tmem63c A T 12: 87,061,554 M114L possibly damaging Het
Trim24 T C 6: 37,871,307 L66P probably damaging Het
Trpm3 T C 19: 22,918,696 F966L possibly damaging Het
Ttn T C 2: 76,779,299 I17588V probably benign Het
Vmn2r44 A T 7: 8,368,228 C606* probably null Het
Vmn2r74 A T 7: 85,952,246 V728E probably benign Het
Zfp503 T C 14: 21,985,951 D299G possibly damaging Het
Other mutations in Krt79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Krt79 APN 15 101940166 missense probably damaging 0.98
IGL00546:Krt79 APN 15 101929873 missense probably benign 0.00
IGL01595:Krt79 APN 15 101931771 missense probably damaging 0.98
IGL02193:Krt79 APN 15 101939905 missense possibly damaging 0.59
R0639:Krt79 UTSW 15 101931548 nonsense probably null
R0980:Krt79 UTSW 15 101938007 missense probably damaging 1.00
R1839:Krt79 UTSW 15 101937938 missense possibly damaging 0.81
R4624:Krt79 UTSW 15 101939806 missense possibly damaging 0.92
R4745:Krt79 UTSW 15 101930684 missense probably damaging 1.00
R5203:Krt79 UTSW 15 101929740 missense unknown
R5382:Krt79 UTSW 15 101931440 missense probably benign 0.09
R5568:Krt79 UTSW 15 101929785 missense probably damaging 0.99
R6902:Krt79 UTSW 15 101931879 missense probably benign 0.08
R6916:Krt79 UTSW 15 101936170 missense probably benign 0.01
R6998:Krt79 UTSW 15 101937872 missense probably benign
R7009:Krt79 UTSW 15 101931441 missense probably damaging 1.00
R7663:Krt79 UTSW 15 101931843 missense probably damaging 0.97
R8161:Krt79 UTSW 15 101930702 missense probably damaging 0.96
R8206:Krt79 UTSW 15 101940270 start gained probably null
Predicted Primers PCR Primer
(F):5'- AGCTGGTGACCCTAACTTCC -3'
(R):5'- CTTTGTTTGCAGCGGTGACC -3'

Sequencing Primer
(F):5'- TTCCACTGCATAACCAAGGAG -3'
(R):5'- GTGACCGGCAACTCTACCTC -3'
Posted On2020-07-13