Mutagenetix > Incidental Mutation

Incidental Mutation 'R8185:Nvl'

634802

Institutional Source

Beutler Lab

Gene Symbol

Nvl

Ensembl Gene

ENSMUSG00000026516

Gene Name

nuclear VCP-like

Synonyms

1200009I24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R8185 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

181087138-181144204 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 181144174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027797] [ENSMUST00000193907]

AlphaFold

Q9DBY8

Predicted Effect

probably benign
Transcript: ENSMUST00000027797

SMART Domains

Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516

Domain	Start	End	E-Value	Type
Pfam:Nucleolin_bd	2	72	1.9e-31	PFAM
low complexity region	90	104	N/A	INTRINSIC
low complexity region	187	201	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
AAA	296	435	2.94e-23	SMART
low complexity region	524	540	N/A	INTRINSIC
AAA	613	749	2.56e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193907

SMART Domains

Protein: ENSMUSP00000141442
Gene: ENSMUSG00000062169

Domain	Start	End	E-Value	Type
Pfam:Cornichon	1	70	1.9e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	C	5: 87,972,152	V256A	possibly damaging	Het
Ackr3	G	A	1: 90,213,944	V42M	probably benign	Het
C9	T	A	15: 6,491,397	I441N	probably damaging	Het
Cd44	G	A	2: 102,824,320	A667V	possibly damaging	Het
Cdc23	T	C	18: 34,641,144	N322D	probably benign	Het
Chrm2	A	G	6: 36,523,889	N227S	probably benign	Het
Cnot1	C	T	8: 95,761,351	R559Q	probably damaging	Het
Cntnap4	A	G	8: 112,665,265	N121D	probably damaging	Het
Cog7	A	G	7: 121,977,746	L63P	probably damaging	Het
Cpne7	C	T	8: 123,127,429	A285V	probably benign	Het
Cpsf7	C	T	19: 10,536,860	R343*	probably null	Het
Cubn	T	G	2: 13,294,318	K3181N	probably benign	Het
Dsg1a	C	T	18: 20,340,612	T914I	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Ebf3	A	T	7: 137,225,878	C255S	possibly damaging	Het
Fasn	A	T	11: 120,812,143	I1658N	probably benign	Het
Fcgr2b	A	G	1: 170,966,451	V210A	probably damaging	Het
Flvcr1	G	A	1: 191,015,484	P305S	probably damaging	Het
Frem3	G	T	8: 80,612,304	E409*	probably null	Het
Gabrr2	T	A	4: 33,082,330	D213E	probably damaging	Het
Ggt1	T	A	10: 75,585,206	D418E	possibly damaging	Het
Gm2046	T	A	12: 87,973,663	W46R	noncoding transcript	Het
Immt	C	T	6: 71,872,851	Q530*	probably null	Het
Ints10	T	C	8: 68,796,718	F67L	possibly damaging	Het
Kdm4c	C	T	4: 74,373,584	H813Y	probably benign	Het
Klhl5	T	A	5: 65,156,128	M395K	probably damaging	Het
Klk11	T	C	7: 43,776,908	I49T	probably damaging	Het
Lmln	A	T	16: 33,089,320	N357I	probably damaging	Het
Lpar1	A	T	4: 58,486,509	M254K	probably damaging	Het
Macc1	T	C	12: 119,447,159	V554A	probably damaging	Het
Melk	G	A	4: 44,360,965	V582I	probably benign	Het
Mmp27	A	G	9: 7,573,491	T195A	unknown	Het
Nedd4l	T	C	18: 65,209,698	F781L	probably damaging	Het
Nxpe4	G	A	9: 48,393,209	D199N	possibly damaging	Het
Olfr145	A	C	9: 37,898,235	Y277S	probably damaging	Het
Olfr267	T	C	4: 58,785,542	Y60C	probably damaging	Het
Ovol1	T	C	19: 5,551,514	D160G	probably damaging	Het
Ppp1r13l	C	T	7: 19,372,938	P453S	probably benign	Het
Ppp1r37	C	T	7: 19,532,948	G373S	probably damaging	Het
Slc7a9	T	C	7: 35,452,417	S46P	probably damaging	Het
Sntn	A	G	14: 13,679,014	I63V	probably benign	Het
Syde2	T	C	3: 145,988,912	V305A	probably benign	Het
Tpp1	A	T	7: 105,749,223		probably null	Het
Vmn1r179	A	T	7: 23,928,738	N118I	possibly damaging	Het

Other mutations in Nvl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Nvl	APN	1	181105125	missense	probably damaging	1.00
IGL00943:Nvl	APN	1	181101634	missense	possibly damaging	0.72
IGL01956:Nvl	APN	1	181134944	missense	probably benign	0.00
IGL02657:Nvl	APN	1	181106976	missense	probably damaging	1.00
Nineveh	UTSW	1	181136906	missense	probably benign	0.00
nubia	UTSW	1	181112334	missense	probably benign	0.19
IGL03098:Nvl	UTSW	1	181093906	missense	probably benign	0.37
P0047:Nvl	UTSW	1	181112302	missense	probably damaging	1.00
R0003:Nvl	UTSW	1	181114133	missense	probably damaging	1.00
R0114:Nvl	UTSW	1	181120391	missense	probably benign	0.19
R0265:Nvl	UTSW	1	181134830	missense	probably damaging	0.96
R0928:Nvl	UTSW	1	181093902	missense	probably benign	0.00
R1398:Nvl	UTSW	1	181097126	splice site	probably benign
R1470:Nvl	UTSW	1	181139262	missense	probably damaging	1.00
R1470:Nvl	UTSW	1	181139262	missense	probably damaging	1.00
R1529:Nvl	UTSW	1	181109159	critical splice donor site	probably null
R1934:Nvl	UTSW	1	181099128	missense	probably damaging	0.96
R2176:Nvl	UTSW	1	181135074	splice site	probably benign
R2351:Nvl	UTSW	1	181130792	missense	probably benign	0.03
R4415:Nvl	UTSW	1	181105114	missense	probably benign
R4570:Nvl	UTSW	1	181144082	missense	probably benign	0.03
R4720:Nvl	UTSW	1	181101587	missense	probably damaging	1.00
R4888:Nvl	UTSW	1	181117626	missense	probably damaging	1.00
R5026:Nvl	UTSW	1	181105155	missense	probably damaging	1.00
R5507:Nvl	UTSW	1	181135036	missense	probably damaging	0.98
R5785:Nvl	UTSW	1	181139298	missense	probably damaging	1.00
R5983:Nvl	UTSW	1	181136906	missense	probably benign	0.00
R6143:Nvl	UTSW	1	181134995	missense	probably benign	0.01
R6532:Nvl	UTSW	1	181144143	splice site	probably null
R6821:Nvl	UTSW	1	181126970	nonsense	probably null
R7062:Nvl	UTSW	1	181112334	missense	probably benign	0.19
R7247:Nvl	UTSW	1	181112286	critical splice donor site	probably null
R7358:Nvl	UTSW	1	181135036	missense	probably damaging	0.98
R7665:Nvl	UTSW	1	181134944	missense	probably benign	0.18
R7795:Nvl	UTSW	1	181097157	missense	probably benign	0.00
R7931:Nvl	UTSW	1	181109155	splice site	probably benign
R8806:Nvl	UTSW	1	181095054	missense	probably benign	0.01
R8933:Nvl	UTSW	1	181139073	missense	probably benign	0.00
R8975:Nvl	UTSW	1	181130436	missense	probably benign
R9249:Nvl	UTSW	1	181135028	missense	probably damaging	1.00
R9584:Nvl	UTSW	1	181130866	missense	probably benign
R9586:Nvl	UTSW	1	181105070	critical splice donor site	probably null
X0067:Nvl	UTSW	1	181139158	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- AAGGGAACATCCAGACCATG -3'
(R):5'- CAGGGCTGGGTAATCTTGAC -3'

Sequencing Primer
(F):5'- AGACCATGCTGGAACCCG -3'
(R):5'- CTGGGTAATCTTGACAAGGAACC -3'

Posted On

2020-07-13