Incidental Mutation 'R8185:Nvl'
ID634802
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R8185 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 181144174 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797] [ENSMUST00000193907]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193907
SMART Domains Protein: ENSMUSP00000141442
Gene: ENSMUSG00000062169

DomainStartEndE-ValueType
Pfam:Cornichon 1 70 1.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,152 V256A possibly damaging Het
Ackr3 G A 1: 90,213,944 V42M probably benign Het
C9 T A 15: 6,491,397 I441N probably damaging Het
Cd44 G A 2: 102,824,320 A667V possibly damaging Het
Cdc23 T C 18: 34,641,144 N322D probably benign Het
Chrm2 A G 6: 36,523,889 N227S probably benign Het
Cnot1 C T 8: 95,761,351 R559Q probably damaging Het
Cntnap4 A G 8: 112,665,265 N121D probably damaging Het
Cog7 A G 7: 121,977,746 L63P probably damaging Het
Cpne7 C T 8: 123,127,429 A285V probably benign Het
Cpsf7 C T 19: 10,536,860 R343* probably null Het
Cubn T G 2: 13,294,318 K3181N probably benign Het
Dsg1a C T 18: 20,340,612 T914I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf3 A T 7: 137,225,878 C255S possibly damaging Het
Fasn A T 11: 120,812,143 I1658N probably benign Het
Fcgr2b A G 1: 170,966,451 V210A probably damaging Het
Frem3 G T 8: 80,612,304 E409* probably null Het
Gabrr2 T A 4: 33,082,330 D213E probably damaging Het
Ggt1 T A 10: 75,585,206 D418E possibly damaging Het
Gm2046 T A 12: 87,973,663 W46R noncoding transcript Het
Immt C T 6: 71,872,851 Q530* probably null Het
Ints10 T C 8: 68,796,718 F67L possibly damaging Het
Kdm4c C T 4: 74,373,584 H813Y probably benign Het
Klhl5 T A 5: 65,156,128 M395K probably damaging Het
Klk11 T C 7: 43,776,908 I49T probably damaging Het
Lmln A T 16: 33,089,320 N357I probably damaging Het
Lpar1 A T 4: 58,486,509 M254K probably damaging Het
Macc1 T C 12: 119,447,159 V554A probably damaging Het
Melk G A 4: 44,360,965 V582I probably benign Het
Mfsd7b G A 1: 191,015,484 P305S probably damaging Het
Mmp27 A G 9: 7,573,491 T195A unknown Het
Nedd4l T C 18: 65,209,698 F781L probably damaging Het
Nxpe4 G A 9: 48,393,209 D199N possibly damaging Het
Olfr145 A C 9: 37,898,235 Y277S probably damaging Het
Olfr267 T C 4: 58,785,542 Y60C probably damaging Het
Ovol1 T C 19: 5,551,514 D160G probably damaging Het
Ppp1r13l C T 7: 19,372,938 P453S probably benign Het
Ppp1r37 C T 7: 19,532,948 G373S probably damaging Het
Slc7a9 T C 7: 35,452,417 S46P probably damaging Het
Sntn A G 14: 13,679,014 I63V probably benign Het
Syde2 T C 3: 145,988,912 V305A probably benign Het
Tpp1 A T 7: 105,749,223 probably null Het
Vmn1r179 A T 7: 23,928,738 N118I possibly damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8806:Nvl UTSW 1 181095054 missense probably benign 0.01
R8933:Nvl UTSW 1 181139073 missense probably benign 0.00
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AAGGGAACATCCAGACCATG -3'
(R):5'- CAGGGCTGGGTAATCTTGAC -3'

Sequencing Primer
(F):5'- AGACCATGCTGGAACCCG -3'
(R):5'- CTGGGTAATCTTGACAAGGAACC -3'
Posted On2020-07-13