Incidental Mutation 'R8185:Nvl'
ID 634802
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 067608-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8185 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 180971739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797] [ENSMUST00000193907]
AlphaFold Q9DBY8
Predicted Effect probably benign
Transcript: ENSMUST00000027797
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193907
SMART Domains Protein: ENSMUSP00000141442
Gene: ENSMUSG00000062169

DomainStartEndE-ValueType
Pfam:Cornichon 1 70 1.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 88,120,011 (GRCm39) V256A possibly damaging Het
Ackr3 G A 1: 90,141,666 (GRCm39) V42M probably benign Het
C9 T A 15: 6,520,878 (GRCm39) I441N probably damaging Het
Cd44 G A 2: 102,654,665 (GRCm39) A667V possibly damaging Het
Cdc23 T C 18: 34,774,197 (GRCm39) N322D probably benign Het
Chrm2 A G 6: 36,500,824 (GRCm39) N227S probably benign Het
Cnot1 C T 8: 96,487,979 (GRCm39) R559Q probably damaging Het
Cntnap4 A G 8: 113,391,897 (GRCm39) N121D probably damaging Het
Cog7 A G 7: 121,576,969 (GRCm39) L63P probably damaging Het
Cpne7 C T 8: 123,854,168 (GRCm39) A285V probably benign Het
Cpsf7 C T 19: 10,514,224 (GRCm39) R343* probably null Het
Cubn T G 2: 13,299,129 (GRCm39) K3181N probably benign Het
Dsg1a C T 18: 20,473,669 (GRCm39) T914I probably damaging Het
Ebf3 A T 7: 136,827,607 (GRCm39) C255S possibly damaging Het
Eif1ad5 T A 12: 87,940,433 (GRCm39) W46R noncoding transcript Het
Fasn A T 11: 120,702,969 (GRCm39) I1658N probably benign Het
Fcgr2b A G 1: 170,794,020 (GRCm39) V210A probably damaging Het
Flvcr1 G A 1: 190,747,681 (GRCm39) P305S probably damaging Het
Frem3 G T 8: 81,338,933 (GRCm39) E409* probably null Het
Gabrr2 T A 4: 33,082,330 (GRCm39) D213E probably damaging Het
Ggt1 T A 10: 75,421,040 (GRCm39) D418E possibly damaging Het
Immt C T 6: 71,849,835 (GRCm39) Q530* probably null Het
Ints10 T C 8: 69,249,370 (GRCm39) F67L possibly damaging Het
Kdm4c C T 4: 74,291,821 (GRCm39) H813Y probably benign Het
Klhl5 T A 5: 65,313,471 (GRCm39) M395K probably damaging Het
Klk1b11 T C 7: 43,426,332 (GRCm39) I49T probably damaging Het
Lmln A T 16: 32,909,690 (GRCm39) N357I probably damaging Het
Lpar1 A T 4: 58,486,509 (GRCm39) M254K probably damaging Het
Macc1 T C 12: 119,410,894 (GRCm39) V554A probably damaging Het
Melk G A 4: 44,360,965 (GRCm39) V582I probably benign Het
Mmp27 A G 9: 7,573,492 (GRCm39) T195A unknown Het
Nedd4l T C 18: 65,342,769 (GRCm39) F781L probably damaging Het
Nxpe4 G A 9: 48,304,509 (GRCm39) D199N possibly damaging Het
Or2k2 T C 4: 58,785,542 (GRCm39) Y60C probably damaging Het
Or8b8 A C 9: 37,809,531 (GRCm39) Y277S probably damaging Het
Ovol1 T C 19: 5,601,542 (GRCm39) D160G probably damaging Het
Ppp1r13l C T 7: 19,106,863 (GRCm39) P453S probably benign Het
Ppp1r37 C T 7: 19,266,873 (GRCm39) G373S probably damaging Het
Slc7a9 T C 7: 35,151,842 (GRCm39) S46P probably damaging Het
Sntn A G 14: 13,679,014 (GRCm38) I63V probably benign Het
Syde2 T C 3: 145,694,667 (GRCm39) V305A probably benign Het
Tpp1 A T 7: 105,398,430 (GRCm39) probably null Het
Vmn1r179 A T 7: 23,628,163 (GRCm39) N118I possibly damaging Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AAGGGAACATCCAGACCATG -3'
(R):5'- CAGGGCTGGGTAATCTTGAC -3'

Sequencing Primer
(F):5'- AGACCATGCTGGAACCCG -3'
(R):5'- CTGGGTAATCTTGACAAGGAACC -3'
Posted On 2020-07-13