Incidental Mutation 'V1662:Cdk2ap1'
ID63481
Institutional Source Beutler Lab
Gene Symbol Cdk2ap1
Ensembl Gene ENSMUSG00000029394
Gene NameCDK2 (cyclin-dependent kinase 2)-associated protein 1
SynonymsDORC1, p12, Doc1, ST19
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V1662 () of strain 633
Quality Score106
Status Not validated
Chromosome5
Chromosomal Location124345417-124363082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124348676 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 68 (I68F)
Ref Sequence ENSEMBL: ENSMUSP00000031341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031341] [ENSMUST00000111472] [ENSMUST00000111473] [ENSMUST00000111474] [ENSMUST00000196910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031341
AA Change: I68F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031341
Gene: ENSMUSG00000029394
AA Change: I68F

DomainStartEndE-ValueType
Pfam:CDK2AP 3 113 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111472
AA Change: I41F

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107097
Gene: ENSMUSG00000029394
AA Change: I41F

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111473
AA Change: I41F

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107098
Gene: ENSMUSG00000029394
AA Change: I41F

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111474
AA Change: I41F

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107099
Gene: ENSMUSG00000029394
AA Change: I41F

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196910
AA Change: I41F

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143268
Gene: ENSMUSG00000029394
AA Change: I41F

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mic homozygous for a knock-out allele die between E3.5 and E5.5 with rare survivors exhibiting craniofacial defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Cdk2ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:Cdk2ap1 APN 5 124350179 splice site probably benign
IGL01979:Cdk2ap1 APN 5 124348709 missense probably damaging 1.00
IGL03240:Cdk2ap1 APN 5 124346144 missense probably damaging 1.00
IGL03047:Cdk2ap1 UTSW 5 124348690 missense possibly damaging 0.54
R2159:Cdk2ap1 UTSW 5 124348604 nonsense probably null
R7144:Cdk2ap1 UTSW 5 124354358 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTCAGAAACCCATGAGCCGC -3'
(R):5'- AGGGCTATGCTTCAGCTAGGACAG -3'

Sequencing Primer
(F):5'- gcatcctcctacctcagcc -3'
(R):5'- TAGGACAGCCCCGGATG -3'
Posted On2013-07-30