Incidental Mutation 'R8185:Kdm4c'
ID634811
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8185 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74373584 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 813 (H813Y)
Ref Sequence ENSEMBL: ENSMUSP00000030102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851]
Predicted Effect probably benign
Transcript: ENSMUST00000030102
AA Change: H813Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: H813Y

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077851
AA Change: H813Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: H813Y

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,152 V256A possibly damaging Het
Ackr3 G A 1: 90,213,944 V42M probably benign Het
C9 T A 15: 6,491,397 I441N probably damaging Het
Cd44 G A 2: 102,824,320 A667V possibly damaging Het
Cdc23 T C 18: 34,641,144 N322D probably benign Het
Chrm2 A G 6: 36,523,889 N227S probably benign Het
Cnot1 C T 8: 95,761,351 R559Q probably damaging Het
Cntnap4 A G 8: 112,665,265 N121D probably damaging Het
Cog7 A G 7: 121,977,746 L63P probably damaging Het
Cpne7 C T 8: 123,127,429 A285V probably benign Het
Cpsf7 C T 19: 10,536,860 R343* probably null Het
Cubn T G 2: 13,294,318 K3181N probably benign Het
Dsg1a C T 18: 20,340,612 T914I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf3 A T 7: 137,225,878 C255S possibly damaging Het
Fasn A T 11: 120,812,143 I1658N probably benign Het
Fcgr2b A G 1: 170,966,451 V210A probably damaging Het
Frem3 G T 8: 80,612,304 E409* probably null Het
Gabrr2 T A 4: 33,082,330 D213E probably damaging Het
Ggt1 T A 10: 75,585,206 D418E possibly damaging Het
Gm2046 T A 12: 87,973,663 W46R noncoding transcript Het
Immt C T 6: 71,872,851 Q530* probably null Het
Ints10 T C 8: 68,796,718 F67L possibly damaging Het
Klhl5 T A 5: 65,156,128 M395K probably damaging Het
Klk11 T C 7: 43,776,908 I49T probably damaging Het
Lmln A T 16: 33,089,320 N357I probably damaging Het
Lpar1 A T 4: 58,486,509 M254K probably damaging Het
Macc1 T C 12: 119,447,159 V554A probably damaging Het
Melk G A 4: 44,360,965 V582I probably benign Het
Mfsd7b G A 1: 191,015,484 P305S probably damaging Het
Mmp27 A G 9: 7,573,491 T195A unknown Het
Nedd4l T C 18: 65,209,698 F781L probably damaging Het
Nvl G A 1: 181,144,174 probably benign Het
Nxpe4 G A 9: 48,393,209 D199N possibly damaging Het
Olfr145 A C 9: 37,898,235 Y277S probably damaging Het
Olfr267 T C 4: 58,785,542 Y60C probably damaging Het
Ovol1 T C 19: 5,551,514 D160G probably damaging Het
Ppp1r13l C T 7: 19,372,938 P453S probably benign Het
Ppp1r37 C T 7: 19,532,948 G373S probably damaging Het
Slc7a9 T C 7: 35,452,417 S46P probably damaging Het
Sntn A G 14: 13,679,014 I63V probably benign Het
Syde2 T C 3: 145,988,912 V305A probably benign Het
Tpp1 A T 7: 105,749,223 probably null Het
Vmn1r179 A T 7: 23,928,738 N118I possibly damaging Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
BB002:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
BB012:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
PIT4434001:Kdm4c UTSW 4 74271332 missense probably benign 0.01
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
R7925:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
R7976:Kdm4c UTSW 4 74377669 missense probably damaging 0.99
R7990:Kdm4c UTSW 4 74391448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCAAAACAGAGAGCGGTG -3'
(R):5'- CAGATCTTACCGCGTTTGAGTTG -3'

Sequencing Primer
(F):5'- GCGGTGATTTTTAAAAATACCAAGG -3'
(R):5'- AGTTGACTCTATGTCTGAAGCATG -3'
Posted On2020-07-13