Incidental Mutation 'R8185:Frem3'
ID634826
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8185 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80612304 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 409 (E409*)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably null
Transcript: ENSMUST00000039695
AA Change: E409*
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: E409*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,152 V256A possibly damaging Het
Ackr3 G A 1: 90,213,944 V42M probably benign Het
C9 T A 15: 6,491,397 I441N probably damaging Het
Cd44 G A 2: 102,824,320 A667V possibly damaging Het
Cdc23 T C 18: 34,641,144 N322D probably benign Het
Chrm2 A G 6: 36,523,889 N227S probably benign Het
Cnot1 C T 8: 95,761,351 R559Q probably damaging Het
Cntnap4 A G 8: 112,665,265 N121D probably damaging Het
Cog7 A G 7: 121,977,746 L63P probably damaging Het
Cpne7 C T 8: 123,127,429 A285V probably benign Het
Cpsf7 C T 19: 10,536,860 R343* probably null Het
Cubn T G 2: 13,294,318 K3181N probably benign Het
Dsg1a C T 18: 20,340,612 T914I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf3 A T 7: 137,225,878 C255S possibly damaging Het
Fasn A T 11: 120,812,143 I1658N probably benign Het
Fcgr2b A G 1: 170,966,451 V210A probably damaging Het
Gabrr2 T A 4: 33,082,330 D213E probably damaging Het
Ggt1 T A 10: 75,585,206 D418E possibly damaging Het
Gm2046 T A 12: 87,973,663 W46R noncoding transcript Het
Immt C T 6: 71,872,851 Q530* probably null Het
Ints10 T C 8: 68,796,718 F67L possibly damaging Het
Kdm4c C T 4: 74,373,584 H813Y probably benign Het
Klhl5 T A 5: 65,156,128 M395K probably damaging Het
Klk11 T C 7: 43,776,908 I49T probably damaging Het
Lmln A T 16: 33,089,320 N357I probably damaging Het
Lpar1 A T 4: 58,486,509 M254K probably damaging Het
Macc1 T C 12: 119,447,159 V554A probably damaging Het
Melk G A 4: 44,360,965 V582I probably benign Het
Mfsd7b G A 1: 191,015,484 P305S probably damaging Het
Mmp27 A G 9: 7,573,491 T195A unknown Het
Nedd4l T C 18: 65,209,698 F781L probably damaging Het
Nvl G A 1: 181,144,174 probably benign Het
Nxpe4 G A 9: 48,393,209 D199N possibly damaging Het
Olfr145 A C 9: 37,898,235 Y277S probably damaging Het
Olfr267 T C 4: 58,785,542 Y60C probably damaging Het
Ovol1 T C 19: 5,551,514 D160G probably damaging Het
Ppp1r13l C T 7: 19,372,938 P453S probably benign Het
Ppp1r37 C T 7: 19,532,948 G373S probably damaging Het
Slc7a9 T C 7: 35,452,417 S46P probably damaging Het
Sntn A G 14: 13,679,014 I63V probably benign Het
Syde2 T C 3: 145,988,912 V305A probably benign Het
Tpp1 A T 7: 105,749,223 probably null Het
Vmn1r179 A T 7: 23,928,738 N118I possibly damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATTCTCAATGTACCCGAGGC -3'
(R):5'- GTGTTGCAAACCTCTGACTG -3'

Sequencing Primer
(F):5'- CCATGGTGGACAGGGTTATG -3'
(R):5'- CCTCTGACTGCAACAATTTTTATTTC -3'
Posted On2020-07-13