Mutagenetix > Incidental Mutations

Incidental Mutation 'R8185:Frem3'

634826

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R8185 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 80612304 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 409 (E409*)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

Predicted Effect

probably null
Transcript: ENSMUST00000039695
AA Change: E409*

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: E409*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	C	5: 87,972,152	V256A	possibly damaging	Het
Ackr3	G	A	1: 90,213,944	V42M	probably benign	Het
C9	T	A	15: 6,491,397	I441N	probably damaging	Het
Cd44	G	A	2: 102,824,320	A667V	possibly damaging	Het
Cdc23	T	C	18: 34,641,144	N322D	probably benign	Het
Chrm2	A	G	6: 36,523,889	N227S	probably benign	Het
Cnot1	C	T	8: 95,761,351	R559Q	probably damaging	Het
Cntnap4	A	G	8: 112,665,265	N121D	probably damaging	Het
Cog7	A	G	7: 121,977,746	L63P	probably damaging	Het
Cpne7	C	T	8: 123,127,429	A285V	probably benign	Het
Cpsf7	C	T	19: 10,536,860	R343*	probably null	Het
Cubn	T	G	2: 13,294,318	K3181N	probably benign	Het
Dsg1a	C	T	18: 20,340,612	T914I	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Ebf3	A	T	7: 137,225,878	C255S	possibly damaging	Het
Fasn	A	T	11: 120,812,143	I1658N	probably benign	Het
Fcgr2b	A	G	1: 170,966,451	V210A	probably damaging	Het
Gabrr2	T	A	4: 33,082,330	D213E	probably damaging	Het
Ggt1	T	A	10: 75,585,206	D418E	possibly damaging	Het
Gm2046	T	A	12: 87,973,663	W46R	noncoding transcript	Het
Immt	C	T	6: 71,872,851	Q530*	probably null	Het
Ints10	T	C	8: 68,796,718	F67L	possibly damaging	Het
Kdm4c	C	T	4: 74,373,584	H813Y	probably benign	Het
Klhl5	T	A	5: 65,156,128	M395K	probably damaging	Het
Klk11	T	C	7: 43,776,908	I49T	probably damaging	Het
Lmln	A	T	16: 33,089,320	N357I	probably damaging	Het
Lpar1	A	T	4: 58,486,509	M254K	probably damaging	Het
Macc1	T	C	12: 119,447,159	V554A	probably damaging	Het
Melk	G	A	4: 44,360,965	V582I	probably benign	Het
Mfsd7b	G	A	1: 191,015,484	P305S	probably damaging	Het
Mmp27	A	G	9: 7,573,491	T195A	unknown	Het
Nedd4l	T	C	18: 65,209,698	F781L	probably damaging	Het
Nvl	G	A	1: 181,144,174		probably benign	Het
Nxpe4	G	A	9: 48,393,209	D199N	possibly damaging	Het
Olfr145	A	C	9: 37,898,235	Y277S	probably damaging	Het
Olfr267	T	C	4: 58,785,542	Y60C	probably damaging	Het
Ovol1	T	C	19: 5,551,514	D160G	probably damaging	Het
Ppp1r13l	C	T	7: 19,372,938	P453S	probably benign	Het
Ppp1r37	C	T	7: 19,532,948	G373S	probably damaging	Het
Slc7a9	T	C	7: 35,452,417	S46P	probably damaging	Het
Sntn	A	G	14: 13,679,014	I63V	probably benign	Het
Syde2	T	C	3: 145,988,912	V305A	probably benign	Het
Tpp1	A	T	7: 105,749,223		probably null	Het
Vmn1r179	A	T	7: 23,928,738	N118I	possibly damaging	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CATTCTCAATGTACCCGAGGC -3'
(R):5'- GTGTTGCAAACCTCTGACTG -3'

Sequencing Primer
(F):5'- CCATGGTGGACAGGGTTATG -3'
(R):5'- CCTCTGACTGCAACAATTTTTATTTC -3'

Posted On

2020-07-13