Mutagenetix > Incidental Mutation

Incidental Mutation 'R8185:Cntnap4'

634828

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

Caspr4, E130114F09Rik

MMRRC Submission

067608-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R8185 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113296675-113609349 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113391897 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 121 (N121D)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: N121D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: N121D

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: N121D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: N121D

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	C	5: 88,120,011 (GRCm39)	V256A	possibly damaging	Het
Ackr3	G	A	1: 90,141,666 (GRCm39)	V42M	probably benign	Het
C9	T	A	15: 6,520,878 (GRCm39)	I441N	probably damaging	Het
Cd44	G	A	2: 102,654,665 (GRCm39)	A667V	possibly damaging	Het
Cdc23	T	C	18: 34,774,197 (GRCm39)	N322D	probably benign	Het
Chrm2	A	G	6: 36,500,824 (GRCm39)	N227S	probably benign	Het
Cnot1	C	T	8: 96,487,979 (GRCm39)	R559Q	probably damaging	Het
Cog7	A	G	7: 121,576,969 (GRCm39)	L63P	probably damaging	Het
Cpne7	C	T	8: 123,854,168 (GRCm39)	A285V	probably benign	Het
Cpsf7	C	T	19: 10,514,224 (GRCm39)	R343*	probably null	Het
Cubn	T	G	2: 13,299,129 (GRCm39)	K3181N	probably benign	Het
Dsg1a	C	T	18: 20,473,669 (GRCm39)	T914I	probably damaging	Het
Ebf3	A	T	7: 136,827,607 (GRCm39)	C255S	possibly damaging	Het
Eif1ad5	T	A	12: 87,940,433 (GRCm39)	W46R	noncoding transcript	Het
Fasn	A	T	11: 120,702,969 (GRCm39)	I1658N	probably benign	Het
Fcgr2b	A	G	1: 170,794,020 (GRCm39)	V210A	probably damaging	Het
Flvcr1	G	A	1: 190,747,681 (GRCm39)	P305S	probably damaging	Het
Frem3	G	T	8: 81,338,933 (GRCm39)	E409*	probably null	Het
Gabrr2	T	A	4: 33,082,330 (GRCm39)	D213E	probably damaging	Het
Ggt1	T	A	10: 75,421,040 (GRCm39)	D418E	possibly damaging	Het
Immt	C	T	6: 71,849,835 (GRCm39)	Q530*	probably null	Het
Ints10	T	C	8: 69,249,370 (GRCm39)	F67L	possibly damaging	Het
Kdm4c	C	T	4: 74,291,821 (GRCm39)	H813Y	probably benign	Het
Klhl5	T	A	5: 65,313,471 (GRCm39)	M395K	probably damaging	Het
Klk1b11	T	C	7: 43,426,332 (GRCm39)	I49T	probably damaging	Het
Lmln	A	T	16: 32,909,690 (GRCm39)	N357I	probably damaging	Het
Lpar1	A	T	4: 58,486,509 (GRCm39)	M254K	probably damaging	Het
Macc1	T	C	12: 119,410,894 (GRCm39)	V554A	probably damaging	Het
Melk	G	A	4: 44,360,965 (GRCm39)	V582I	probably benign	Het
Mmp27	A	G	9: 7,573,492 (GRCm39)	T195A	unknown	Het
Nedd4l	T	C	18: 65,342,769 (GRCm39)	F781L	probably damaging	Het
Nvl	G	A	1: 180,971,739 (GRCm39)		probably benign	Het
Nxpe4	G	A	9: 48,304,509 (GRCm39)	D199N	possibly damaging	Het
Or2k2	T	C	4: 58,785,542 (GRCm39)	Y60C	probably damaging	Het
Or8b8	A	C	9: 37,809,531 (GRCm39)	Y277S	probably damaging	Het
Ovol1	T	C	19: 5,601,542 (GRCm39)	D160G	probably damaging	Het
Ppp1r13l	C	T	7: 19,106,863 (GRCm39)	P453S	probably benign	Het
Ppp1r37	C	T	7: 19,266,873 (GRCm39)	G373S	probably damaging	Het
Slc7a9	T	C	7: 35,151,842 (GRCm39)	S46P	probably damaging	Het
Sntn	A	G	14: 13,679,014 (GRCm38)	I63V	probably benign	Het
Syde2	T	C	3: 145,694,667 (GRCm39)	V305A	probably benign	Het
Tpp1	A	T	7: 105,398,430 (GRCm39)		probably null	Het
Vmn1r179	A	T	7: 23,628,163 (GRCm39)	N118I	possibly damaging	Het
Zfp764l1	C	T	7: 126,992,496 (GRCm39)	C38Y	probably null	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	113,494,251 (GRCm39)	splice site	probably benign
IGL01898:Cntnap4	APN	8	113,582,939 (GRCm39)	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	113,478,866 (GRCm39)	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	113,343,126 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	113,512,535 (GRCm39)	splice site	probably benign
IGL02621:Cntnap4	APN	8	113,537,355 (GRCm39)	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	113,500,222 (GRCm39)	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	113,512,416 (GRCm39)	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	113,569,148 (GRCm39)	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	113,583,143 (GRCm39)	nonsense	probably null
R0497:Cntnap4	UTSW	8	113,296,783 (GRCm39)	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	113,608,395 (GRCm39)	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	113,608,462 (GRCm39)	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	113,484,155 (GRCm39)	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	113,542,128 (GRCm39)	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	113,484,203 (GRCm39)	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	113,484,071 (GRCm39)	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	113,478,939 (GRCm39)	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	113,480,554 (GRCm39)	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	113,391,898 (GRCm39)	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	113,584,842 (GRCm39)	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	113,537,240 (GRCm39)	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	113,537,342 (GRCm39)	missense	probably benign
R4611:Cntnap4	UTSW	8	113,500,371 (GRCm39)	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	113,512,468 (GRCm39)	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	113,460,070 (GRCm39)	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	113,568,385 (GRCm39)	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	113,602,061 (GRCm39)	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	113,569,353 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	113,529,843 (GRCm39)	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	113,478,921 (GRCm39)	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	113,484,105 (GRCm39)	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	113,529,858 (GRCm39)	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	113,584,874 (GRCm39)	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	113,537,268 (GRCm39)	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	113,608,432 (GRCm39)	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	113,391,731 (GRCm39)	splice site	probably null
R7348:Cntnap4	UTSW	8	113,391,909 (GRCm39)	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	113,460,194 (GRCm39)	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	113,484,113 (GRCm39)	missense	probably benign
R7895:Cntnap4	UTSW	8	113,478,829 (GRCm39)	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	113,480,577 (GRCm39)	missense	probably damaging	0.99
R8197:Cntnap4	UTSW	8	113,296,857 (GRCm39)	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	113,500,324 (GRCm39)	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	113,484,228 (GRCm39)	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	113,585,759 (GRCm39)	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	113,479,598 (GRCm39)	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	113,479,646 (GRCm39)	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	113,602,600 (GRCm39)	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	113,500,276 (GRCm39)	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	113,460,103 (GRCm39)	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	113,582,982 (GRCm39)	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	113,602,181 (GRCm39)	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	113,568,349 (GRCm39)	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	113,391,808 (GRCm39)	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	113,568,496 (GRCm39)	missense	probably damaging	0.97
R9765:Cntnap4	UTSW	8	113,484,110 (GRCm39)	missense	probably benign	0.00
R9793:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	113,542,152 (GRCm39)	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	113,584,821 (GRCm39)	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	113,479,002 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTGGAAGTCGTTCTGAATCC -3'
(R):5'- AGCTTCCCTTAAGAGATGGTATC -3'

Sequencing Primer
(F):5'- GGAAGTCGTTCTGAATCCCTTACAG -3'
(R):5'- CCCTTAAGAGATGGTATCAGGGTCAC -3'

Posted On

2020-07-13