Mutagenetix > Incidental Mutations

Incidental Mutation 'V1662:Pyroxd1'

63483

Institutional Source

Beutler Lab

Gene Symbol

Pyroxd1

Ensembl Gene

ENSMUSG00000041671

Gene Name

pyridine nucleotide-disulphide oxidoreductase domain 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V1662 () of strain 633

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

142345654-142363257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 142358443 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 307 (G307S)

Ref Sequence

ENSEMBL: ENSMUSP00000036394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]

Predicted Effect

probably benign
Transcript: ENSMUST00000032370

SMART Domains

Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	2.5e-27	SMART
HELICc	328	409	2.2e-26	SMART
Pfam:RQC	488	592	5.5e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000041852
AA Change: G307S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: G307S

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	8	234	2.2e-18	PFAM
Pfam:Pyr_redox_2	266	381	4e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100832

SMART Domains

Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RQC	488	592	1.1e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111803

SMART Domains

Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RecQ_Zn_bind	420	479	2.5e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123289

Predicted Effect

probably benign
Transcript: ENSMUST00000123912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138578

Predicted Effect

probably benign
Transcript: ENSMUST00000141504

SMART Domains

Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
Pfam:RecQ_Zn_bind	10	69	7.1e-16	PFAM
Pfam:RQC	73	187	2.5e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154870

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Amph	G	A	13: 19,139,370	V601M	probably benign	Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cacna1h	T	C	17: 25,377,309	N1913D	possibly damaging	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
Cfap44	C	A	16: 44,449,138	Y1168*	probably null	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Itgav	C	T	2: 83,783,854	R519W	possibly damaging	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Pyroxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Pyroxd1	APN	6	142361758	missense	probably damaging	0.96
IGL01720:Pyroxd1	APN	6	142351058	splice site	probably benign
IGL02139:Pyroxd1	APN	6	142354731	missense	probably benign
IGL02930:Pyroxd1	APN	6	142359052	missense	probably damaging	1.00
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0329:Pyroxd1	UTSW	6	142361976	missense	probably benign	0.37
R0505:Pyroxd1	UTSW	6	142353562	missense	possibly damaging	0.55
R0552:Pyroxd1	UTSW	6	142345737	missense	probably benign	0.06
R1073:Pyroxd1	UTSW	6	142348644	critical splice donor site	probably null
R1319:Pyroxd1	UTSW	6	142359148	missense	probably benign	0.33
R2200:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R4638:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4639:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4640:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4641:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4642:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4643:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4645:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4687:Pyroxd1	UTSW	6	142361868	missense	probably benign	0.00
R5359:Pyroxd1	UTSW	6	142361991	missense	probably damaging	1.00
R5688:Pyroxd1	UTSW	6	142353540	missense	probably damaging	1.00
R6208:Pyroxd1	UTSW	6	142357456	missense	probably benign	0.00
R6295:Pyroxd1	UTSW	6	142354753	missense	probably benign	0.00
R7056:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R7445:Pyroxd1	UTSW	6	142358501	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGTACAAGACTGCCATTGCGCTC -3'
(R):5'- CGGATGTTAACTGCTGGACGCTAAG -3'

Sequencing Primer
(F):5'- TCAGTTGTCTCGGCCAATG -3'
(R):5'- TTAACTGCTGGACGCTAAGTAGAAG -3'

Posted On

2013-07-30