Incidental Mutation 'R8185:Mmp27'
ID 634830
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 067608-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8185 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571397-7581886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7573492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 195 (T195A)
Ref Sequence ENSEMBL: ENSMUSP00000117469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably benign
Transcript: ENSMUST00000120900
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000151853
AA Change: T195A
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: T195A

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 88,120,011 (GRCm39) V256A possibly damaging Het
Ackr3 G A 1: 90,141,666 (GRCm39) V42M probably benign Het
C9 T A 15: 6,520,878 (GRCm39) I441N probably damaging Het
Cd44 G A 2: 102,654,665 (GRCm39) A667V possibly damaging Het
Cdc23 T C 18: 34,774,197 (GRCm39) N322D probably benign Het
Chrm2 A G 6: 36,500,824 (GRCm39) N227S probably benign Het
Cnot1 C T 8: 96,487,979 (GRCm39) R559Q probably damaging Het
Cntnap4 A G 8: 113,391,897 (GRCm39) N121D probably damaging Het
Cog7 A G 7: 121,576,969 (GRCm39) L63P probably damaging Het
Cpne7 C T 8: 123,854,168 (GRCm39) A285V probably benign Het
Cpsf7 C T 19: 10,514,224 (GRCm39) R343* probably null Het
Cubn T G 2: 13,299,129 (GRCm39) K3181N probably benign Het
Dsg1a C T 18: 20,473,669 (GRCm39) T914I probably damaging Het
Ebf3 A T 7: 136,827,607 (GRCm39) C255S possibly damaging Het
Eif1ad5 T A 12: 87,940,433 (GRCm39) W46R noncoding transcript Het
Fasn A T 11: 120,702,969 (GRCm39) I1658N probably benign Het
Fcgr2b A G 1: 170,794,020 (GRCm39) V210A probably damaging Het
Flvcr1 G A 1: 190,747,681 (GRCm39) P305S probably damaging Het
Frem3 G T 8: 81,338,933 (GRCm39) E409* probably null Het
Gabrr2 T A 4: 33,082,330 (GRCm39) D213E probably damaging Het
Ggt1 T A 10: 75,421,040 (GRCm39) D418E possibly damaging Het
Immt C T 6: 71,849,835 (GRCm39) Q530* probably null Het
Ints10 T C 8: 69,249,370 (GRCm39) F67L possibly damaging Het
Kdm4c C T 4: 74,291,821 (GRCm39) H813Y probably benign Het
Klhl5 T A 5: 65,313,471 (GRCm39) M395K probably damaging Het
Klk1b11 T C 7: 43,426,332 (GRCm39) I49T probably damaging Het
Lmln A T 16: 32,909,690 (GRCm39) N357I probably damaging Het
Lpar1 A T 4: 58,486,509 (GRCm39) M254K probably damaging Het
Macc1 T C 12: 119,410,894 (GRCm39) V554A probably damaging Het
Melk G A 4: 44,360,965 (GRCm39) V582I probably benign Het
Nedd4l T C 18: 65,342,769 (GRCm39) F781L probably damaging Het
Nvl G A 1: 180,971,739 (GRCm39) probably benign Het
Nxpe4 G A 9: 48,304,509 (GRCm39) D199N possibly damaging Het
Or2k2 T C 4: 58,785,542 (GRCm39) Y60C probably damaging Het
Or8b8 A C 9: 37,809,531 (GRCm39) Y277S probably damaging Het
Ovol1 T C 19: 5,601,542 (GRCm39) D160G probably damaging Het
Ppp1r13l C T 7: 19,106,863 (GRCm39) P453S probably benign Het
Ppp1r37 C T 7: 19,266,873 (GRCm39) G373S probably damaging Het
Slc7a9 T C 7: 35,151,842 (GRCm39) S46P probably damaging Het
Sntn A G 14: 13,679,014 (GRCm38) I63V probably benign Het
Syde2 T C 3: 145,694,667 (GRCm39) V305A probably benign Het
Tpp1 A T 7: 105,398,430 (GRCm39) probably null Het
Vmn1r179 A T 7: 23,628,163 (GRCm39) N118I possibly damaging Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7,573,505 (GRCm39) splice site probably benign
IGL00656:Mmp27 APN 9 7,581,383 (GRCm39) missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7,578,900 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7,573,416 (GRCm39) missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7,573,298 (GRCm39) missense probably benign 0.06
IGL01631:Mmp27 APN 9 7,573,289 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7,571,591 (GRCm39) missense probably benign 0.03
IGL03024:Mmp27 APN 9 7,581,377 (GRCm39) missense probably benign 0.17
R0662:Mmp27 UTSW 9 7,577,651 (GRCm39) missense probably benign 0.00
R0715:Mmp27 UTSW 9 7,581,156 (GRCm39) splice site probably benign
R0826:Mmp27 UTSW 9 7,579,010 (GRCm39) missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7,579,067 (GRCm39) splice site probably null
R1793:Mmp27 UTSW 9 7,571,459 (GRCm39) start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7,578,898 (GRCm39) splice site probably null
R2074:Mmp27 UTSW 9 7,577,740 (GRCm39) missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7,577,379 (GRCm39) nonsense probably null
R2445:Mmp27 UTSW 9 7,581,182 (GRCm39) missense probably benign 0.12
R2961:Mmp27 UTSW 9 7,573,603 (GRCm39) missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7,581,195 (GRCm39) missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R4938:Mmp27 UTSW 9 7,578,983 (GRCm39) missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7,579,001 (GRCm39) missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7,572,159 (GRCm39) missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R5446:Mmp27 UTSW 9 7,573,516 (GRCm39) splice site probably benign
R5485:Mmp27 UTSW 9 7,573,363 (GRCm39) missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7,579,063 (GRCm39) missense probably null 1.00
R6682:Mmp27 UTSW 9 7,573,606 (GRCm39) missense probably benign 0.02
R6712:Mmp27 UTSW 9 7,572,177 (GRCm39) missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7,571,955 (GRCm39) missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7,578,231 (GRCm39) missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7,577,318 (GRCm39) missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7,579,002 (GRCm39) missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7,578,985 (GRCm39) missense probably damaging 0.97
R8537:Mmp27 UTSW 9 7,579,776 (GRCm39) missense probably benign 0.00
R9039:Mmp27 UTSW 9 7,581,250 (GRCm39) missense probably benign 0.01
R9087:Mmp27 UTSW 9 7,579,858 (GRCm39) missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7,579,792 (GRCm39) missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7,579,812 (GRCm39) missense probably benign 0.09
R9367:Mmp27 UTSW 9 7,573,550 (GRCm39) missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7,573,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCTGATGTGGATGAGG -3'
(R):5'- CTGTACAGTGCTTCTTTCTAGATG -3'

Sequencing Primer
(F):5'- GATGAGGCTATTCAGAAAGCTCTAC -3'
(R):5'- TCTCACAGTGAAAATTAGTCTCACC -3'
Posted On 2020-07-13