Incidental Mutation 'R8185:C9'
ID634838
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8185 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6491397 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 441 (I441N)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749]
Predicted Effect probably damaging
Transcript: ENSMUST00000022749
AA Change: I441N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: I441N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,152 V256A possibly damaging Het
Ackr3 G A 1: 90,213,944 V42M probably benign Het
Cd44 G A 2: 102,824,320 A667V possibly damaging Het
Cdc23 T C 18: 34,641,144 N322D probably benign Het
Chrm2 A G 6: 36,523,889 N227S probably benign Het
Cnot1 C T 8: 95,761,351 R559Q probably damaging Het
Cntnap4 A G 8: 112,665,265 N121D probably damaging Het
Cog7 A G 7: 121,977,746 L63P probably damaging Het
Cpne7 C T 8: 123,127,429 A285V probably benign Het
Cpsf7 C T 19: 10,536,860 R343* probably null Het
Cubn T G 2: 13,294,318 K3181N probably benign Het
Dsg1a C T 18: 20,340,612 T914I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf3 A T 7: 137,225,878 C255S possibly damaging Het
Fasn A T 11: 120,812,143 I1658N probably benign Het
Fcgr2b A G 1: 170,966,451 V210A probably damaging Het
Frem3 G T 8: 80,612,304 E409* probably null Het
Gabrr2 T A 4: 33,082,330 D213E probably damaging Het
Ggt1 T A 10: 75,585,206 D418E possibly damaging Het
Gm2046 T A 12: 87,973,663 W46R noncoding transcript Het
Immt C T 6: 71,872,851 Q530* probably null Het
Ints10 T C 8: 68,796,718 F67L possibly damaging Het
Kdm4c C T 4: 74,373,584 H813Y probably benign Het
Klhl5 T A 5: 65,156,128 M395K probably damaging Het
Klk11 T C 7: 43,776,908 I49T probably damaging Het
Lmln A T 16: 33,089,320 N357I probably damaging Het
Lpar1 A T 4: 58,486,509 M254K probably damaging Het
Macc1 T C 12: 119,447,159 V554A probably damaging Het
Melk G A 4: 44,360,965 V582I probably benign Het
Mfsd7b G A 1: 191,015,484 P305S probably damaging Het
Mmp27 A G 9: 7,573,491 T195A unknown Het
Nedd4l T C 18: 65,209,698 F781L probably damaging Het
Nvl G A 1: 181,144,174 probably benign Het
Nxpe4 G A 9: 48,393,209 D199N possibly damaging Het
Olfr145 A C 9: 37,898,235 Y277S probably damaging Het
Olfr267 T C 4: 58,785,542 Y60C probably damaging Het
Ovol1 T C 19: 5,551,514 D160G probably damaging Het
Ppp1r13l C T 7: 19,372,938 P453S probably benign Het
Ppp1r37 C T 7: 19,532,948 G373S probably damaging Het
Slc7a9 T C 7: 35,452,417 S46P probably damaging Het
Sntn A G 14: 13,679,014 I63V probably benign Het
Syde2 T C 3: 145,988,912 V305A probably benign Het
Tpp1 A T 7: 105,749,223 probably null Het
Vmn1r179 A T 7: 23,928,738 N118I possibly damaging Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTCCTAGATTATGGAGG -3'
(R):5'- TCAGTGTAGGGGAATGCCAG -3'

Sequencing Primer
(F):5'- CCTAGATTATGGAGGGGAGATTTATG -3'
(R):5'- ACCCTCATAGGAGCAGCTG -3'
Posted On2020-07-13