Incidental Mutation 'R8186:Toporsl'
ID634853
Institutional Source Beutler Lab
Gene Symbol Toporsl
Ensembl Gene ENSMUSG00000028314
Gene Nametopoisomerase I binding, arginine/serine-rich like
Synonyms4930547C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8186 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52596274-52612430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52610489 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 127 (F127L)
Ref Sequence ENSEMBL: ENSMUSP00000029995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029995] [ENSMUST00000107671]
Predicted Effect probably damaging
Transcript: ENSMUST00000029995
AA Change: F127L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029995
Gene: ENSMUSG00000028314
AA Change: F127L

DomainStartEndE-ValueType
low complexity region 256 263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107671
AA Change: F127L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103298
Gene: ENSMUSG00000028314
AA Change: F127L

DomainStartEndE-ValueType
low complexity region 256 263 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,286,631 T1921A probably damaging Het
Add2 G A 6: 86,108,020 V543M probably benign Het
Agl A G 3: 116,758,908 I459T possibly damaging Het
Atg16l2 C T 7: 101,296,507 probably null Het
BC048403 T A 10: 121,745,342 F83I possibly damaging Het
C130073F10Rik G A 4: 101,890,834 R48* probably null Het
Cdc25b C T 2: 131,189,130 T125M probably benign Het
Cdc42bpg T A 19: 6,306,865 F50L probably damaging Het
Chd9 T A 8: 90,998,605 D1187E unknown Het
Col4a2 T C 8: 11,425,542 probably null Het
Cped1 T C 6: 22,123,588 S447P probably benign Het
Ddx19a T A 8: 110,983,642 M109L probably benign Het
Def8 C A 8: 123,461,476 Y431* probably null Het
Dusp27 A G 1: 166,100,079 S655P probably damaging Het
Gata4 A G 14: 63,201,513 S373P probably benign Het
Gm8926 A G 5: 11,773,959 D158G probably damaging Het
Gm9837 A T 11: 53,470,309 L26* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hspa1b A T 17: 34,957,581 V476E probably damaging Het
Htr5b G A 1: 121,528,379 probably benign Het
Hydin T C 8: 110,609,645 V5018A probably benign Het
Ighv1-85 A G 12: 116,000,303 S26P probably benign Het
Lrrc2 A G 9: 110,960,842 K56E possibly damaging Het
Macf1 A T 4: 123,372,426 I6793N probably damaging Het
Macf1 A C 4: 123,382,130 V6215G possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,559,012 probably null Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Oprk1 A T 1: 5,602,317 M226L probably benign Het
Phf2 A G 13: 48,807,751 L821P unknown Het
Rdh7 C A 10: 127,887,415 probably null Het
Rpl11 A G 4: 136,051,657 V74A possibly damaging Het
Safb2 G A 17: 56,566,051 R790C possibly damaging Het
Sgpp2 T C 1: 78,416,972 F204S probably benign Het
Sgsm3 A C 15: 81,009,442 I426L possibly damaging Het
Tbccd1 A G 16: 22,818,439 L545P probably damaging Het
Ttc25 A G 11: 100,563,679 D430G probably benign Het
Ttn T G 2: 76,918,912 Q3931P probably damaging Het
Tuba1c C A 15: 99,037,515 L286I probably benign Het
Usp48 A G 4: 137,621,196 R528G possibly damaging Het
Utrn T C 10: 12,698,123 T1068A probably benign Het
Vmn2r103 A T 17: 19,811,943 T660S probably damaging Het
Vmn2r105 G T 17: 20,224,618 Y537* probably null Het
Vmn2r88 A T 14: 51,418,700 I744F Het
Wnt9b T C 11: 103,730,775 E352G probably damaging Het
Zfp78 A G 7: 6,373,229 N46D probably damaging Het
Other mutations in Toporsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Toporsl APN 4 52610172 missense probably benign 0.21
IGL01611:Toporsl APN 4 52610794 missense probably damaging 1.00
IGL02638:Toporsl APN 4 52611624 missense probably benign 0.39
IGL02642:Toporsl APN 4 52611114 missense probably benign 0.09
IGL03410:Toporsl APN 4 52611134 missense probably benign 0.07
torsion UTSW 4 52610489 missense probably damaging 1.00
wound UTSW 4 52612140 missense possibly damaging 0.90
IGL03134:Toporsl UTSW 4 52610281 missense probably damaging 0.97
R0548:Toporsl UTSW 4 52612140 missense possibly damaging 0.90
R1444:Toporsl UTSW 4 52610254 missense probably benign 0.01
R2165:Toporsl UTSW 4 52612072 missense possibly damaging 0.47
R2295:Toporsl UTSW 4 52610176 missense probably damaging 0.99
R3410:Toporsl UTSW 4 52610970 missense probably benign 0.10
R3905:Toporsl UTSW 4 52611750 nonsense probably null
R4719:Toporsl UTSW 4 52611996 missense probably benign 0.21
R4782:Toporsl UTSW 4 52610845 missense probably damaging 1.00
R5642:Toporsl UTSW 4 52611515 nonsense probably null
R5724:Toporsl UTSW 4 52611346 missense probably damaging 1.00
R5728:Toporsl UTSW 4 52611469 missense probably benign
R6433:Toporsl UTSW 4 52611548 missense possibly damaging 0.91
R7023:Toporsl UTSW 4 52611211 missense possibly damaging 0.47
R7292:Toporsl UTSW 4 52611630 missense probably benign 0.14
R7294:Toporsl UTSW 4 52611903 missense probably benign 0.03
R7408:Toporsl UTSW 4 52612108 missense probably benign 0.12
R7673:Toporsl UTSW 4 52610679 missense probably damaging 1.00
R7974:Toporsl UTSW 4 52611645 missense probably damaging 1.00
R8156:Toporsl UTSW 4 52609975 start gained probably benign
R8744:Toporsl UTSW 4 52611967 missense probably benign 0.01
X0065:Toporsl UTSW 4 52610539 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGTTTCTCGCTTCAGAGG -3'
(R):5'- TCGTCATGTGATGGAGAATGGC -3'

Sequencing Primer
(F):5'- TCTCGCTTCAGAGGAGGAAAGTTC -3'
(R):5'- TGTGTAACCATAGTCTCCACAG -3'
Posted On2020-07-13